ID: 927288042

View in Genome Browser
Species Human (GRCh38)
Location 2:21377446-21377468
Sequence CTGGCTTCCCAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927288039_927288042 -5 Left 927288039 2:21377428-21377450 CCTTTGGTTCTATGGGTACTGGC No data
Right 927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG No data
927288037_927288042 -1 Left 927288037 2:21377424-21377446 CCTGCCTTTGGTTCTATGGGTAC No data
Right 927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG No data
927288036_927288042 0 Left 927288036 2:21377423-21377445 CCCTGCCTTTGGTTCTATGGGTA No data
Right 927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG No data
927288033_927288042 10 Left 927288033 2:21377413-21377435 CCACTCACTTCCCTGCCTTTGGT No data
Right 927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927288042 Original CRISPR CTGGCTTCCCAGAAGGAAGG AGG Intergenic
No off target data available for this crispr