ID: 927293955

View in Genome Browser
Species Human (GRCh38)
Location 2:21431990-21432012
Sequence CAGGGAGAACAGAAGCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927293954_927293955 -9 Left 927293954 2:21431976-21431998 CCAGAGAGTATGAACAGGGAGAA No data
Right 927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG No data
927293953_927293955 -8 Left 927293953 2:21431975-21431997 CCCAGAGAGTATGAACAGGGAGA No data
Right 927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG No data
927293950_927293955 5 Left 927293950 2:21431962-21431984 CCATTGAGGGAATCCCAGAGAGT No data
Right 927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927293955 Original CRISPR CAGGGAGAACAGAAGCAGTA AGG Intergenic
No off target data available for this crispr