ID: 927295478

View in Genome Browser
Species Human (GRCh38)
Location 2:21448040-21448062
Sequence TTTATATTGTGGGGAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927295478_927295483 19 Left 927295478 2:21448040-21448062 CCTTTGATTCCCCACAATATAAA No data
Right 927295483 2:21448082-21448104 TTGCCTGCATTGTACAGGTGAGG No data
927295478_927295482 14 Left 927295478 2:21448040-21448062 CCTTTGATTCCCCACAATATAAA No data
Right 927295482 2:21448077-21448099 TATTATTGCCTGCATTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927295478 Original CRISPR TTTATATTGTGGGGAATCAA AGG (reversed) Intergenic
No off target data available for this crispr