ID: 927308032

View in Genome Browser
Species Human (GRCh38)
Location 2:21596185-21596207
Sequence CTTTATTAGCAGAATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927308030_927308032 -6 Left 927308030 2:21596168-21596190 CCCAGTCTTGGGTTTGTCTTTAT 0: 25
1: 2322
2: 4230
3: 7477
4: 9096
Right 927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG No data
927308031_927308032 -7 Left 927308031 2:21596169-21596191 CCAGTCTTGGGTTTGTCTTTATT 0: 14
1: 945
2: 3078
3: 5459
4: 7695
Right 927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG No data
927308029_927308032 -5 Left 927308029 2:21596167-21596189 CCCCAGTCTTGGGTTTGTCTTTA No data
Right 927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927308032 Original CRISPR CTTTATTAGCAGAATGAGAA TGG Intergenic
No off target data available for this crispr