ID: 927311252

View in Genome Browser
Species Human (GRCh38)
Location 2:21634115-21634137
Sequence CAGCATGTCAGGAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927311247_927311252 8 Left 927311247 2:21634084-21634106 CCGCATTATGTCAATTATGTTCC No data
Right 927311252 2:21634115-21634137 CAGCATGTCAGGAAGGAGCAAGG No data
927311246_927311252 9 Left 927311246 2:21634083-21634105 CCCGCATTATGTCAATTATGTTC No data
Right 927311252 2:21634115-21634137 CAGCATGTCAGGAAGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927311252 Original CRISPR CAGCATGTCAGGAAGGAGCA AGG Intergenic
No off target data available for this crispr