ID: 927314132

View in Genome Browser
Species Human (GRCh38)
Location 2:21662583-21662605
Sequence TATGGTTGTAGGGCTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927314126_927314132 8 Left 927314126 2:21662552-21662574 CCCATTCACGTGTTAGCAGAATT No data
Right 927314132 2:21662583-21662605 TATGGTTGTAGGGCTGTTGCTGG No data
927314125_927314132 13 Left 927314125 2:21662547-21662569 CCTTGCCCATTCACGTGTTAGCA No data
Right 927314132 2:21662583-21662605 TATGGTTGTAGGGCTGTTGCTGG No data
927314127_927314132 7 Left 927314127 2:21662553-21662575 CCATTCACGTGTTAGCAGAATTC No data
Right 927314132 2:21662583-21662605 TATGGTTGTAGGGCTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927314132 Original CRISPR TATGGTTGTAGGGCTGTTGC TGG Intergenic
No off target data available for this crispr