ID: 927314302

View in Genome Browser
Species Human (GRCh38)
Location 2:21664296-21664318
Sequence TGGCATGGCAAGAGTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927314295_927314302 13 Left 927314295 2:21664260-21664282 CCACTTATGACGGAAGGTGAGGT No data
Right 927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927314302 Original CRISPR TGGCATGGCAAGAGTGAGCA AGG Intergenic
No off target data available for this crispr