ID: 927315633

View in Genome Browser
Species Human (GRCh38)
Location 2:21677853-21677875
Sequence CAAGCCCCTCCCACTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927315631_927315633 -10 Left 927315631 2:21677840-21677862 CCTCTCATTTTTGCAAGCCCCTC No data
Right 927315633 2:21677853-21677875 CAAGCCCCTCCCACTCCAGGTGG No data
927315630_927315633 -7 Left 927315630 2:21677837-21677859 CCTCCTCTCATTTTTGCAAGCCC No data
Right 927315633 2:21677853-21677875 CAAGCCCCTCCCACTCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927315633 Original CRISPR CAAGCCCCTCCCACTCCAGG TGG Intergenic
No off target data available for this crispr