ID: 927317820

View in Genome Browser
Species Human (GRCh38)
Location 2:21706121-21706143
Sequence GTATCAAGTCAGCTGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927317820_927317824 8 Left 927317820 2:21706121-21706143 CCAGACCACAGCTGACTTGATAC No data
Right 927317824 2:21706152-21706174 GGGCGTGACTTTTCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927317820 Original CRISPR GTATCAAGTCAGCTGTGGTC TGG (reversed) Intergenic
No off target data available for this crispr