ID: 927317824

View in Genome Browser
Species Human (GRCh38)
Location 2:21706152-21706174
Sequence GGGCGTGACTTTTCAGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927317820_927317824 8 Left 927317820 2:21706121-21706143 CCAGACCACAGCTGACTTGATAC No data
Right 927317824 2:21706152-21706174 GGGCGTGACTTTTCAGTCTCTGG No data
927317821_927317824 3 Left 927317821 2:21706126-21706148 CCACAGCTGACTTGATACTAGCT No data
Right 927317824 2:21706152-21706174 GGGCGTGACTTTTCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927317824 Original CRISPR GGGCGTGACTTTTCAGTCTC TGG Intergenic
No off target data available for this crispr