ID: 927317824 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:21706152-21706174 |
| Sequence | GGGCGTGACTTTTCAGTCTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927317821_927317824 | 3 | Left | 927317821 | 2:21706126-21706148 | CCACAGCTGACTTGATACTAGCT | No data | ||
| Right | 927317824 | 2:21706152-21706174 | GGGCGTGACTTTTCAGTCTCTGG | No data | ||||
| 927317820_927317824 | 8 | Left | 927317820 | 2:21706121-21706143 | CCAGACCACAGCTGACTTGATAC | No data | ||
| Right | 927317824 | 2:21706152-21706174 | GGGCGTGACTTTTCAGTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927317824 | Original CRISPR | GGGCGTGACTTTTCAGTCTC TGG | Intergenic | ||