ID: 927317896

View in Genome Browser
Species Human (GRCh38)
Location 2:21706881-21706903
Sequence CTTTTTTACCTAAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927317896_927317899 27 Left 927317896 2:21706881-21706903 CCATTTGTCCTTAGGTAAAAAAG No data
Right 927317899 2:21706931-21706953 TCCCTCAAACGTCTGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927317896 Original CRISPR CTTTTTTACCTAAGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr