ID: 927317899

View in Genome Browser
Species Human (GRCh38)
Location 2:21706931-21706953
Sequence TCCCTCAAACGTCTGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927317896_927317899 27 Left 927317896 2:21706881-21706903 CCATTTGTCCTTAGGTAAAAAAG No data
Right 927317899 2:21706931-21706953 TCCCTCAAACGTCTGATGAATGG No data
927317897_927317899 19 Left 927317897 2:21706889-21706911 CCTTAGGTAAAAAAGTTGCAGTG No data
Right 927317899 2:21706931-21706953 TCCCTCAAACGTCTGATGAATGG No data
927317898_927317899 -9 Left 927317898 2:21706917-21706939 CCAAAGTCAAAAATTCCCTCAAA No data
Right 927317899 2:21706931-21706953 TCCCTCAAACGTCTGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927317899 Original CRISPR TCCCTCAAACGTCTGATGAA TGG Intergenic
No off target data available for this crispr