ID: 927327345

View in Genome Browser
Species Human (GRCh38)
Location 2:21820367-21820389
Sequence GAAATAAATTTCTGTTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1182
Summary {0: 9, 1: 53, 2: 135, 3: 204, 4: 781}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927327345_927327348 12 Left 927327345 2:21820367-21820389 CCTAAACAACAGAAATTTATTTC 0: 9
1: 53
2: 135
3: 204
4: 781
Right 927327348 2:21820402-21820424 GAATCTGAACTCTGAAATCAAGG No data
927327345_927327350 23 Left 927327345 2:21820367-21820389 CCTAAACAACAGAAATTTATTTC 0: 9
1: 53
2: 135
3: 204
4: 781
Right 927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG No data
927327345_927327349 18 Left 927327345 2:21820367-21820389 CCTAAACAACAGAAATTTATTTC 0: 9
1: 53
2: 135
3: 204
4: 781
Right 927327349 2:21820408-21820430 GAACTCTGAAATCAAGGTGCCGG No data
927327345_927327346 -10 Left 927327345 2:21820367-21820389 CCTAAACAACAGAAATTTATTTC 0: 9
1: 53
2: 135
3: 204
4: 781
Right 927327346 2:21820380-21820402 AATTTATTTCCTCACAGTTCTGG 0: 62
1: 631
2: 2064
3: 3910
4: 6598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927327345 Original CRISPR GAAATAAATTTCTGTTGTTT AGG (reversed) Intergenic
900006638 1:59959-59981 GACATTAATTGCTTTTGTTTTGG + Intergenic
901293862 1:8145753-8145775 AAAATAAATTTCTGTGGTGGAGG + Intergenic
901862983 1:12086645-12086667 GAAATAAATGTCTATTGTTTAGG - Intronic
902657096 1:17876634-17876656 GAAATAAATTTTTATTATTTAGG + Intergenic
906626406 1:47329567-47329589 AAAATAAATGTTTCTTGTTTTGG + Intergenic
906699763 1:47849429-47849451 GAAGTACATTCCTGTTGCTTCGG + Intronic
907335936 1:53699654-53699676 GAAATAAATTTCTGTTGTTTTGG - Intronic
907632857 1:56101442-56101464 AAAATATACTTCTGTTGTTTAGG - Intergenic
907710620 1:56877219-56877241 AAAATAAACTTCTGTTGTGTAGG + Intronic
907939898 1:59077541-59077563 GAAATACATTTCTGTAGTAATGG + Intergenic
908466327 1:64399660-64399682 AAAATAAATTTCTGTTGCTTAGG - Intergenic
908746367 1:67380641-67380663 ACAATAGATTTCTGTTGATTAGG - Intronic
908790588 1:67777140-67777162 GAAATAACACTCTGTTGTTTTGG + Intronic
908808242 1:67952806-67952828 AAAATAAATTTCTGTTGTTAAGG - Intergenic
908825840 1:68131979-68132001 AAAACAAGCTTCTGTTGTTTAGG + Intronic
908850209 1:68368180-68368202 GAAATAAATTCCTTTTCTTTGGG + Intergenic
909046267 1:70713845-70713867 AATATAACTTCCTGTTGTTTAGG + Intergenic
909162776 1:72174725-72174747 GAAATAACTTCCTGCTCTTTTGG - Intronic
909338592 1:74505983-74506005 GAAATCACTTTTTGTTTTTTTGG + Intronic
909445199 1:75741759-75741781 AAAATAAGTTTGTGTTGTTTAGG + Intronic
909477950 1:76103597-76103619 AGAATACATTTCTGTTGTCTAGG - Intronic
909515418 1:76501815-76501837 GAAATAAACTTTTATTGTTTAGG - Intronic
909523637 1:76597991-76598013 GTAATAAACTTTTGGTGTTTAGG - Intronic
909868492 1:80706522-80706544 AAAATAAATTTCTATTGTTTAGG - Intergenic
909969715 1:81967212-81967234 AAAATAAATTTGTGTGGTTATGG + Intronic
910062456 1:83110231-83110253 GAAATAAATTCCTGCTGTTTAGG + Intergenic
910348971 1:86274442-86274464 GAAAAAAATTTCTGTTGCATTGG - Intergenic
910454959 1:87387745-87387767 AAAATAAATTTCTGTTGTTTAGG - Intergenic
910465823 1:87498538-87498560 AAGTTTAATTTCTGTTGTTTTGG + Intergenic
910783611 1:90969366-90969388 AAAATAAATTTCTATTGTTTAGG + Intronic
911121191 1:94298664-94298686 GAGATACATTTCTGTTCTTATGG + Intergenic
911178009 1:94836557-94836579 GAAATACAATTCTTTTGTTGGGG + Intronic
911617131 1:100026511-100026533 TAAATACATTTCTATTTTTTTGG + Exonic
911691271 1:100837480-100837502 GAAATAAATGTTTGTCATTTAGG - Intergenic
912039167 1:105364251-105364273 AAACTAAATATCTGTAGTTTAGG - Intergenic
912350658 1:109009331-109009353 GAAATAAATAACTGTTGATCAGG + Intronic
912710917 1:111949141-111949163 GAAATAAAATGCTTTTGTCTGGG + Intronic
913708810 1:121457957-121457979 GAAATGAATTTGTGTATTTTAGG + Intergenic
914207470 1:145545728-145545750 GAAATAATTTTATTTTCTTTGGG + Intergenic
914340210 1:146753817-146753839 AAAAGAAACTTCTGTTGGTTAGG - Intergenic
914493108 1:148166282-148166304 AAGTTTAATTTCTGTTGTTTTGG - Intergenic
914518523 1:148394697-148394719 GAAACACATTTCTATAGTTTAGG - Intergenic
914576944 1:148980962-148980984 TAATGAAATTTCTCTTGTTTGGG + Intronic
914998255 1:152563639-152563661 GAGACAAATTTCTGTCTTTTGGG - Intronic
915675870 1:157529949-157529971 TAAAAAAATTTCAGTAGTTTTGG - Intronic
915817780 1:158988139-158988161 ACCATAAACTTCTGTTGTTTAGG + Intergenic
915907749 1:159891184-159891206 AAAGTAAATTTCTGTTCTCTAGG + Intronic
915998638 1:160591839-160591861 GACAGAATTTTCTGTTCTTTTGG + Intergenic
916202004 1:162281026-162281048 GAGATGAATTTCTGTTCTGTGGG - Intronic
916300782 1:163271537-163271559 GAAATAAATTTCTGTGGTTTAGG + Intronic
916609589 1:166377921-166377943 AAAATAACTTTCACTTGTTTGGG + Intergenic
917212771 1:172646938-172646960 AAAATAACTTTCTGTTGTTTAGG + Intergenic
917527451 1:175801662-175801684 GAAATACATTTCTGCTGTCTCGG - Intergenic
917685966 1:177416388-177416410 GAAATAAATTTCTGTTGCTTAGG + Intergenic
918088360 1:181264292-181264314 GAAGAAAATTTCTGTCTTTTCGG - Intergenic
918121351 1:181543673-181543695 GAAATAAATTTCTGTTGTTGAGG + Intronic
918503922 1:185230286-185230308 CAAATACATTTCTGTTGTTTTGG - Intronic
918559924 1:185853188-185853210 GAAATAAATTCATTTTGTTGAGG - Intronic
918594082 1:186272771-186272793 TAAGTAAATTTCAGATGTTTAGG - Intergenic
918605620 1:186421893-186421915 TAAATAAATTTCTTTTCCTTTGG - Intergenic
918620000 1:186592233-186592255 GAAAGTATATTCTGTTGTTTTGG - Intergenic
918701150 1:187609462-187609484 GATATAACTTTATCTTGTTTGGG - Intergenic
918860547 1:189820565-189820587 GCAAGAAATTTCTGTTACTTAGG + Intergenic
918950489 1:191129892-191129914 GAATTAAATTTTTGTTGTGCTGG - Intergenic
919004592 1:191880454-191880476 GAGATAAATATGTGTTGTTTAGG - Intergenic
919223971 1:194669912-194669934 TAAATAAATGTCATTTGTTTGGG + Intergenic
920156085 1:203952819-203952841 AATATAAACTTCTTTTGTTTAGG - Intergenic
921250950 1:213297597-213297619 GAAATAACTATATGTGGTTTGGG + Intergenic
921254140 1:213324478-213324500 AAAATAAATGTCTGTTGCTTAGG + Intergenic
921314997 1:213882054-213882076 AACATAAATCTCTATTGTTTAGG + Intergenic
921353905 1:214266390-214266412 TAAATAAATTGCTTTTCTTTTGG - Intergenic
921410319 1:214829578-214829600 GAAATAAATGTTTGTGGTTTAGG - Intergenic
921606884 1:217166354-217166376 GAAAGAATTTTCATTTGTTTTGG + Intergenic
921811371 1:219518122-219518144 CAAATAATTTTAAGTTGTTTTGG + Intergenic
921826801 1:219681195-219681217 GAAATAAATGTCTGTTGCTTAGG - Intergenic
921930632 1:220751644-220751666 GATATTTTTTTCTGTTGTTTTGG + Intronic
922126492 1:222730641-222730663 GTGATAAATTTCAGTTGTGTAGG + Intronic
922529480 1:226332942-226332964 AAAATAATTTTCCTTTGTTTTGG - Intergenic
922893578 1:229081649-229081671 AAAATAACTTTCTGTAATTTGGG + Intergenic
922893751 1:229083451-229083473 AAAATAAATCTCTGTTGTTTAGG + Intergenic
923057974 1:230442499-230442521 GAAATACATTTTTGAAGTTTTGG - Intergenic
923255011 1:232214311-232214333 GAATTGGATGTCTGTTGTTTAGG + Intergenic
923443885 1:234049535-234049557 AAAATGCATTTCTGTTGTTTAGG + Intronic
923778469 1:237000355-237000377 TAAATAAATTGTTGTTGTTAAGG - Intergenic
923877907 1:238070340-238070362 CATATATATTTCTGTTTTTTTGG + Intergenic
924014463 1:239705406-239705428 GCACTAAGTTTCTGTTGTTTAGG - Intronic
924077285 1:240353483-240353505 GCAATAAATTGCTGTTGGATGGG - Intronic
924571217 1:245239484-245239506 AAAATGATTTTCTTTTGTTTGGG + Intronic
924815492 1:247438092-247438114 GCAATAAACTCTTGTTGTTTAGG - Intronic
924855119 1:247868233-247868255 AAAATAAATTTCTGCTGATCTGG - Intronic
1062833108 10:619269-619291 AAAATAAGTTCGTGTTGTTTGGG - Intronic
1063402826 10:5763993-5764015 AAAATAAAGCTCTTTTGTTTAGG - Intergenic
1063428643 10:5968703-5968725 GAAATAACACTCTGTGGTTTAGG - Intronic
1063479709 10:6364332-6364354 AAAATAAATGTCTGTTGTTTAGG - Intergenic
1063719954 10:8569921-8569943 CAAATATATATCTGTTTTTTTGG - Intergenic
1063750014 10:8933703-8933725 ACAATAAATTTCTGTTGTTTAGG - Intergenic
1064004984 10:11692286-11692308 CAAGAAAATTTCTGTCGTTTTGG - Intergenic
1064288046 10:14009979-14010001 GAAATGAGTTTCTCTTGCTTTGG - Intronic
1064293840 10:14059620-14059642 GAAATACATTTCTACTGTTTAGG + Intronic
1064486408 10:15796735-15796757 GAAAGAAATTTCTGTCCTCTAGG - Intronic
1064549720 10:16487217-16487239 AGACTAAATTTCTGTTGTTTAGG - Intronic
1064645631 10:17455833-17455855 AAAATAAATTTCTGTTCTTTCGG + Intergenic
1064888634 10:20142037-20142059 GAAATTAATTTCTCTCTTTTTGG - Intronic
1065232825 10:23616049-23616071 TAAATAGATTTCTTTTCTTTTGG + Intergenic
1065253140 10:23837223-23837245 GAGATAAATTTCTCTTGTTCAGG + Intronic
1065702737 10:28441350-28441372 GAAATAACCTTGTGTTGTATGGG - Intergenic
1065783177 10:29189649-29189671 GAAATAAACATTTGTTGTTCAGG - Intergenic
1065845248 10:29737720-29737742 AAAATCAATTTCTGTTGCTTAGG - Intergenic
1065991480 10:31014241-31014263 CAGTTAAATTTCTGTTGTTGTGG - Intronic
1066330606 10:34417584-34417606 GAAAATAATTTCGATTGTTTGGG + Intronic
1066583067 10:36901596-36901618 AAAATAGATTTCTGTTGTTTTGG - Intergenic
1067003641 10:42640783-42640805 GAAGTAAATTTCTCTTGCTGAGG - Intergenic
1067932681 10:50578780-50578802 GAAATAATTTTGTGGTGTTGGGG - Intronic
1067976055 10:51026221-51026243 ACAATAAATTTCTATTGTTTAGG + Intronic
1068298573 10:55108187-55108209 GAAATCAATGTTTGTTGGTTAGG + Intronic
1068562597 10:58532345-58532367 AAAATAAATTCCTGCTGATTTGG + Intronic
1068757344 10:60670181-60670203 GATGTACATTTCAGTTGTTTGGG - Intronic
1068800402 10:61133792-61133814 AAAATAATTTTCTGTTCATTGGG - Intergenic
1069072258 10:64001006-64001028 GAATGTAAATTCTGTTGTTTTGG - Intergenic
1069089200 10:64178879-64178901 GGAATAAGTTTCTTTTCTTTTGG - Intergenic
1069115389 10:64498878-64498900 GAAATAAATGTCTGTTGTTTAGG + Intergenic
1069312097 10:67050968-67050990 TAAATAAATATTTGTTGTTGTGG - Intronic
1069322799 10:67193849-67193871 AAAATGAATTTCTGTTTTTTAGG + Intronic
1070081467 10:73192324-73192346 TAGATAAATGTCTGTTTTTTAGG - Intronic
1070345889 10:75541509-75541531 AAAATAAATTTCACTTGTGTGGG - Intronic
1070374362 10:75814959-75814981 GACCAACATTTCTGTTGTTTTGG - Intronic
1071035214 10:81236767-81236789 AAAACATATATCTGTTGTTTTGG + Intergenic
1071063015 10:81596232-81596254 GAATATAAATTCTGTTGTTTTGG - Intergenic
1071228025 10:83554256-83554278 AAAATAAATCTCTCTTGTTTAGG - Intergenic
1071765101 10:88655185-88655207 AAAATAAATTTATGTTGTTTAGG + Intergenic
1071868962 10:89770679-89770701 GTAATACATATTTGTTGTTTTGG + Intronic
1072005039 10:91237192-91237214 GAATTAAATATATGTTGATTAGG + Intronic
1072343017 10:94473779-94473801 TAAATAAATTTCAGAAGTTTGGG + Intronic
1072390363 10:94978467-94978489 GAAATATTTTTCTGTTTGTTGGG + Intronic
1072892412 10:99335736-99335758 AAAATAAATTTCTGTTGTTTAGG - Intronic
1073401644 10:103262289-103262311 GAAATAAACCTCTGTAGGTTAGG - Intergenic
1073591224 10:104759315-104759337 AAGATAAATATCTGTTGTTTAGG + Intronic
1073923150 10:108481891-108481913 GAAATAAATGTTTCTTATTTAGG - Intergenic
1074033467 10:109713117-109713139 AAAATAAACTTCTGTTGTTTAGG - Intergenic
1074343705 10:112659965-112659987 CATTTAAATTTCTATTGTTTTGG + Intronic
1074420351 10:113303259-113303281 GAAACAAATTTCTGTCACTTAGG - Intergenic
1074431680 10:113400144-113400166 AGAATACATTTCTGTTGTTCAGG - Intergenic
1075020077 10:118945618-118945640 TAAATAAATGTCTGTTGCTAAGG + Intergenic
1075243087 10:120795521-120795543 GAAATATATTTTTGCTATTTTGG + Intergenic
1075512468 10:123083642-123083664 GGAATAAATTTCTGTCATTTAGG + Intergenic
1076156970 10:128211810-128211832 GAAATAAAATTCTGCTGCTGCGG + Intergenic
1077276291 11:1711319-1711341 AAATTGAATTTCTATTGTTTAGG + Intergenic
1077705059 11:4477095-4477117 GAAATAAATTTCTGTTTATTAGG + Intergenic
1078301775 11:10138022-10138044 TAAATAAATTTCTATTTTTTTGG + Intronic
1078479964 11:11667159-11667181 AGCATAAATTTCTGTTCTTTTGG - Intergenic
1078591781 11:12647577-12647599 GAAAGAAATTGCAGTTTTTTTGG - Intergenic
1078593809 11:12669576-12669598 AAAATAACCTTCTGTTGTTCTGG - Intergenic
1078644922 11:13132344-13132366 GAAAAAAATTCATCTTGTTTGGG - Intergenic
1078731797 11:13981718-13981740 GAAATAAACTTATGTTGTGGAGG - Intronic
1079229350 11:18635968-18635990 ACAATAAATGTCTGTTGTTTAGG + Intergenic
1079253084 11:18801927-18801949 GGAAAAAATGTCTTTTGTTTTGG + Intergenic
1079284122 11:19114047-19114069 GGAACAAATTTCTTTTGTTTAGG + Intergenic
1079337944 11:19587812-19587834 GAACTAAATTTCTATTGTGTTGG - Intronic
1079358779 11:19753134-19753156 GAAATGAATGTTTCTTGTTTAGG + Intronic
1079366325 11:19813433-19813455 GAAATAAATCACTGTTTCTTTGG - Intronic
1079782324 11:24623159-24623181 GGAATAGATTTATGTTGTTTGGG - Intronic
1080575109 11:33591635-33591657 GAACTAAATCTCTGCTGTTGTGG - Intronic
1080672961 11:34398234-34398256 GATATAAATGTCAGTTCTTTTGG + Intergenic
1080906011 11:36545528-36545550 AAAATAAATTTCTGTTATTTAGG + Intronic
1080995873 11:37600903-37600925 GAAATAAATTAATGTGGATTTGG - Intergenic
1080999646 11:37652810-37652832 TAAATCAATTTTTTTTGTTTTGG + Intergenic
1081465913 11:43316930-43316952 CACAGAAATTTCTGTTATTTGGG + Intronic
1082271870 11:50180881-50180903 TAAGTAAATTTCTTTTTTTTTGG + Intergenic
1082301287 11:50509463-50509485 GAAATAATTCCCTGTTGTTCTGG - Intergenic
1082681887 11:56184013-56184035 TAAGTAAATTTCTATTGTTTAGG - Intergenic
1082720850 11:56674415-56674437 GCAATAAATATCAGTTCTTTTGG - Intergenic
1083531434 11:63426812-63426834 GAAAATAATTTCTTTTCTTTTGG + Intergenic
1084230289 11:67747423-67747445 AAAATCAATGTCTGTTATTTAGG + Intergenic
1084610115 11:70196813-70196835 AGAATAAATTCGTGTTGTTTTGG - Intergenic
1085676130 11:78520572-78520594 AATATAAATTTCTGTTTTTATGG - Intronic
1085766267 11:79285514-79285536 GACATAAATTTCAGTTCTTTGGG - Intronic
1085904123 11:80739258-80739280 AAAATACATTTCTGTTGTTTTGG + Intergenic
1086333134 11:85773721-85773743 AAAATAAATTTCTGGTCTTTTGG - Intronic
1086557714 11:88131342-88131364 AAAATAAATCTGTCTTGTTTAGG - Intronic
1087002859 11:93438931-93438953 GAGATAAATGTTTGTTGTTTAGG - Intergenic
1087597376 11:100271360-100271382 AAAATAATTTTATGATGTTTAGG - Intronic
1087664288 11:101025403-101025425 GACAGAAACTTCTTTTGTTTTGG + Intergenic
1087764352 11:102133824-102133846 GAAATAAATTTCTCTCGTTTGGG - Intronic
1087987084 11:104695844-104695866 GTTAGAGATTTCTGTTGTTTGGG + Intergenic
1088112999 11:106283239-106283261 GAAATAAATCTCTGTTGTTTAGG + Intergenic
1088424060 11:109681954-109681976 GAATTAAATTTTCGTTATTTTGG - Intergenic
1089821900 11:121236223-121236245 GAAGTAAATTTTTCTGGTTTGGG + Intergenic
1090200905 11:124855481-124855503 AAAATATATATTTGTTGTTTTGG - Intergenic
1090827102 11:130395415-130395437 AAAATACATTTCTGTTGTATAGG + Intergenic
1090863835 11:130677553-130677575 AAAAGACATTTCTCTTGTTTGGG - Intronic
1090873527 11:130768984-130769006 GAAATAAATTTCTGTTCCTTAGG - Intergenic
1091892804 12:4074002-4074024 GAAATAAATATCTGTTGTTTAGG + Intergenic
1091959033 12:4674848-4674870 GAAATTATATTCTGTTGATTTGG - Intronic
1092267913 12:6997361-6997383 CACATAATTTGCTGTTGTTTTGG - Exonic
1092322659 12:7494695-7494717 GAAAGAATTTTCTTTTTTTTTGG - Intronic
1092931757 12:13322187-13322209 GAAATAAGTGTTTGTTGCTTAGG + Intergenic
1092965157 12:13634360-13634382 GAAATGAAATTCTATTGTGTTGG - Intronic
1093139415 12:15490493-15490515 GAAATACTATTCTTTTGTTTAGG + Intronic
1093167210 12:15817846-15817868 GAAAGAAATGCTTGTTGTTTAGG - Intronic
1093327250 12:17792552-17792574 GAAATAATTTTATTTTATTTGGG + Intergenic
1093340216 12:17965036-17965058 GAATGTAAATTCTGTTGTTTTGG + Intergenic
1093377141 12:18443657-18443679 GAAAGAATTTTCTGTTCATTAGG - Intronic
1093672525 12:21894529-21894551 AAAAGAATGTTCTGTTGTTTTGG + Intronic
1093791185 12:23252159-23252181 GAAATAAATTTCTCTCTTTGGGG - Intergenic
1093993353 12:25614773-25614795 AAAATAAATTTCTGTTGTTTAGG - Intronic
1094249654 12:28344967-28344989 GAAATAAATTTCTAATGATGAGG - Intronic
1094533429 12:31299313-31299335 GAAAAAAATTTTTTTTTTTTTGG + Intronic
1094638990 12:32255014-32255036 GAAATCAATTTCTGTTGTTTGGG - Intronic
1095358582 12:41307212-41307234 GAAATAAGTATCTTTTGTTTAGG - Intronic
1095619006 12:44226853-44226875 AAAATAAAGATCTGTTGTTTAGG + Intronic
1095668719 12:44834151-44834173 GAAATATATTATTGATGTTTGGG - Intronic
1095992233 12:48043266-48043288 GCAATAAATATTTGTTGCTTTGG + Exonic
1096249502 12:50019924-50019946 GAAGTGAGTTTCTTTTGTTTAGG + Intronic
1096314555 12:50552812-50552834 AAAATAAACTTCTTATGTTTAGG + Intronic
1097139472 12:56887796-56887818 GAAATAATTTTCTCTTTATTGGG + Intergenic
1097411442 12:59258454-59258476 GAAAATAATTTCTGTTGGCTTGG + Intergenic
1097449600 12:59720339-59720361 GATATACATTTCTGTTGTTATGG - Intronic
1097533350 12:60834122-60834144 GAAAAATCTTTCTGTAGTTTTGG + Intergenic
1097958904 12:65513504-65513526 GAAATAAATTTCGGTTGTTTGGG + Intergenic
1098023587 12:66179988-66180010 AAAATAAATGTTTGTTTTTTAGG + Intergenic
1098286208 12:68909399-68909421 GAAAAAAATTAGTGTTGGTTAGG + Intronic
1098689325 12:73466751-73466773 AAAATAAGTTTCTGTTGTTTAGG + Intergenic
1098772876 12:74576814-74576836 AAAGTAAATTTCTGTTGTTTAGG + Intergenic
1099081366 12:78186761-78186783 AAAATAAATTTCTGTTGTTTAGG - Intronic
1099102907 12:78464896-78464918 TAAATATATTTCTGTATTTTAGG - Intergenic
1099147956 12:79071556-79071578 AGAATAAATTTCTTTTGTTGAGG - Intronic
1099688665 12:85922643-85922665 ACAATAAATTTGTGTGGTTTAGG - Intergenic
1100144749 12:91664074-91664096 GCAATAAATTACTCATGTTTGGG + Intergenic
1100379926 12:94051916-94051938 ATAATAAAATTCTGTTGTTTGGG - Intergenic
1100687615 12:97003973-97003995 GAAATAAATTTCTGTTCTATAGG - Intergenic
1101003143 12:100376196-100376218 AAAATACATTTCTGTTGTTTAGG + Intronic
1101182635 12:102236115-102236137 ACAATAAATTTCTAGTGTTTAGG - Intergenic
1101285143 12:103304019-103304041 GAAGGAAATTTCTATTTTTTTGG - Intronic
1102191802 12:110994398-110994420 AAGATAAATTTCTGTTCTTTAGG - Intergenic
1102395078 12:112578542-112578564 GAACTAGATTTCTGTCATTTTGG + Intronic
1103118122 12:118355235-118355257 TAAAAAAATTTTTTTTGTTTTGG - Intronic
1103144245 12:118580674-118580696 AAAATAAATTTCTTTACTTTGGG + Intergenic
1103670500 12:122610749-122610771 GAAAGATAAGTCTGTTGTTTTGG + Intronic
1103674855 12:122647650-122647672 AAAATAAACTTCTGTTGTTTTGG - Intergenic
1103737123 12:123067710-123067732 AGAATAAATTTCTGCTGTTTAGG + Intronic
1103769294 12:123308124-123308146 AAATAAAATTTCTGTTGTCTTGG + Intronic
1104202958 12:126609536-126609558 GAACCACATTTCAGTTGTTTTGG - Intergenic
1104285936 12:127424767-127424789 AAAAGAAATTTCTGTTACTTAGG + Intergenic
1105304087 13:19157173-19157195 GCAATAAATTTGAGTTGTTTTGG + Intergenic
1105660690 13:22491140-22491162 GAAATAACTTTCTTCTGTTGAGG - Intergenic
1106329928 13:28730651-28730673 GGAATACATTTCTGCTGTGTAGG - Intergenic
1106632466 13:31490487-31490509 GAAATAAATGTAAGTTATTTGGG - Intergenic
1106695393 13:32167250-32167272 AGAATAAATTTTTGGTGTTTAGG - Intronic
1106947452 13:34844725-34844747 GAAATAATTCTCTGTATTTTAGG - Intergenic
1106982842 13:35310273-35310295 GAACAAAATTTCTGTTATTTGGG + Intronic
1106988890 13:35391824-35391846 GAAATAACTTTCTGATGACTTGG - Intronic
1107096066 13:36537358-36537380 GAAACAAATTTGAGCTGTTTGGG - Intergenic
1107146244 13:37063406-37063428 GAAATAAATTTCTGTCGCTTAGG - Intergenic
1107331319 13:39304172-39304194 GAATCAAATTCCTGTTGCTTTGG - Intergenic
1107510927 13:41083594-41083616 GAAATGTATTTCTGTTCTTCAGG + Exonic
1107514214 13:41113494-41113516 GAAATAACTTTCTGTTATTTAGG - Intergenic
1107529191 13:41265802-41265824 GAAACAAATTTCTGTTGTTTAGG + Intergenic
1107692183 13:42964894-42964916 GAAATAATTCTCTGGTGCTTTGG + Intronic
1107840941 13:44457470-44457492 GAATTTTATTTCTGTTGCTTGGG - Intronic
1108220014 13:48224029-48224051 CAAGTAGATTTCTCTTGTTTTGG + Intergenic
1108374203 13:49798099-49798121 GAAATAAGTTTCTGTTGGCCGGG + Intergenic
1108451751 13:50574112-50574134 GAAATATATCTTAGTTGTTTGGG - Intronic
1108807288 13:54174650-54174672 TAAATAATATTCAGTTGTTTGGG + Intergenic
1108948111 13:56048834-56048856 AAAATAAACTTGTGATGTTTTGG - Intergenic
1109013475 13:56978890-56978912 GAAATAAATTCCTGTTGTTTAGG + Intergenic
1109036594 13:57270164-57270186 GAAAGAAATTGCTTTTGGTTTGG - Intergenic
1109083624 13:57941397-57941419 GACATAAATATTTGTTGTTGGGG - Intergenic
1109096909 13:58130526-58130548 GCAATAGATTTCTCTTTTTTTGG + Intergenic
1109183282 13:59240343-59240365 CAAGTACATGTCTGTTGTTTAGG + Intergenic
1109383557 13:61597864-61597886 TAAATAAATATCTGGAGTTTGGG + Intergenic
1109430525 13:62227741-62227763 GAAATTAATTTATAATGTTTTGG + Intergenic
1109803734 13:67408822-67408844 TAAAGCAACTTCTGTTGTTTTGG + Intergenic
1109902131 13:68787918-68787940 AAAATAAATTTTTGTTGTTTAGG + Intergenic
1110170816 13:72498372-72498394 GAATTAAATTTCAGTTATTCTGG + Intergenic
1110297895 13:73890376-73890398 GATATCAATGTCTGTTATTTTGG - Intronic
1110426572 13:75373924-75373946 AAAAGAAAGTTTTGTTGTTTGGG - Intronic
1110511756 13:76359056-76359078 GAAATAAATAGGTATTGTTTTGG - Intergenic
1110686798 13:78384995-78385017 GAAATAAATTTATGTTCTGATGG - Intergenic
1110820302 13:79907947-79907969 GAAATAAATATTTGTTATTTAGG - Intergenic
1110836667 13:80091569-80091591 GAAAGTATATTCTGTTGTTTTGG + Intergenic
1111003759 13:82221326-82221348 TAAATAATTTTAAGTTGTTTGGG + Intergenic
1111081510 13:83316047-83316069 GAAATAACATTTGGTTGTTTTGG + Intergenic
1111152871 13:84281316-84281338 GTAGTAACTTTCTGCTGTTTGGG - Intergenic
1111357202 13:87123918-87123940 GAAACAAATATCTGTTACTTAGG - Intergenic
1111792858 13:92880777-92880799 GAGATAAATCTCTGTGGTCTTGG + Intergenic
1111911292 13:94315314-94315336 GAAATAAACTTGTGTTGTTGTGG - Intronic
1111932408 13:94525405-94525427 GTGATACATTTCTGATGTTTAGG + Intergenic
1111946360 13:94669757-94669779 AAAATAAATTTCTGTTGTTTAGG - Intergenic
1112208905 13:97353590-97353612 GAAATAAATGTCTTTTATTCTGG - Intronic
1112315734 13:98360603-98360625 GGAATAAACTTCTGTAGTTTAGG + Intronic
1112344871 13:98580819-98580841 GAAATAAATTTCTGTCGTTTTGG - Intergenic
1112727224 13:102318402-102318424 ACAATACATGTCTGTTGTTTAGG - Intronic
1113381351 13:109808904-109808926 GAAATTCATGTCTGCTGTTTTGG + Intergenic
1113789461 13:113019922-113019944 GAGATAAATTTCTGTTGTTTGGG + Intronic
1113984847 13:114305593-114305615 GAACAAAATTTCTGTTATTTGGG - Exonic
1114244334 14:20898876-20898898 GAAAGAAATTTCTGTTGTTTCGG - Intergenic
1114247324 14:20927028-20927050 GAAAGAAATTTCTGTTGTTTTGG - Intergenic
1114888333 14:26883356-26883378 AAAATAAATTTCACTTGTTAAGG + Intergenic
1114893955 14:26962199-26962221 GAATTAAATTGCTATTATTTTGG + Intergenic
1115372149 14:32628745-32628767 GAAAAAAAAATCTGGTGTTTTGG - Intronic
1115394522 14:32892752-32892774 GAAATGATATTCTGTTTTTTTGG + Intergenic
1115702383 14:35966823-35966845 AAAATAAATTTCTGTTGTTCAGG + Intergenic
1116244073 14:42385759-42385781 AAAATAAATTTTTGTTATTTGGG - Intergenic
1116399011 14:44482307-44482329 GAAATAAATATCTTTATTTTTGG - Intergenic
1116469718 14:45272831-45272853 TAAATAAATTTGATTTGTTTGGG + Intergenic
1116700333 14:48232942-48232964 AAAATAAATGTCTGTTGTTAAGG + Intergenic
1116807644 14:49509417-49509439 AAAATAAATTTCTGTTGTTTAGG + Intergenic
1117704256 14:58446901-58446923 GAAAATATTTTCTGTTGTTCAGG + Intronic
1117904856 14:60574052-60574074 GAAAAAAATTTTTTTTGGTTGGG + Intergenic
1118074297 14:62281596-62281618 GGAATAAATGTCTATTGTTTAGG - Intergenic
1118387470 14:65268204-65268226 CAAACACATTTCTGTTGTTTAGG - Intergenic
1118997784 14:70852946-70852968 GAAATACATTTTTGCTGTGTAGG + Intergenic
1119902677 14:78274584-78274606 GAAACAATTTTCTGCAGTTTGGG - Intronic
1120095595 14:80384320-80384342 GAAATAAATGTCTGTTGGCCGGG - Intronic
1120373873 14:83675127-83675149 GAAATAAATTTGTATTTTTAGGG + Intergenic
1120474648 14:84972043-84972065 GAAATAAATTTCTGTTGGAGGGG - Intergenic
1120650169 14:87122982-87123004 GAAATTTATTTCAGGTGTTTGGG + Intergenic
1120877999 14:89392411-89392433 GAAATACATTTCTATTGTTGGGG - Intronic
1121195237 14:92066101-92066123 TAAATAAATTTCTGTTTCTCTGG + Intronic
1121487932 14:94332926-94332948 GAAAGAAAATTCTATTATTTGGG - Intergenic
1121538727 14:94709387-94709409 GGAATACCTTTCTTTTGTTTTGG + Intergenic
1121840849 14:97132561-97132583 GCAACAAATGTCTGTTGTTTAGG - Intergenic
1121856663 14:97276562-97276584 ATAATACATTTGTGTTGTTTAGG + Intergenic
1121881453 14:97503980-97504002 GAAATTAATTTCTTATGGTTCGG - Intergenic
1121950857 14:98170182-98170204 GAAAAAAAATTCACTTGTTTAGG - Intergenic
1122024687 14:98867257-98867279 CAAATAAATGTCTGTCATTTGGG + Intergenic
1122120434 14:99550476-99550498 AGAATAAATGTGTGTTGTTTAGG + Intronic
1123813615 15:23954601-23954623 GAAATAAATCTTTGTGGCTTAGG - Intergenic
1124100580 15:26689315-26689337 GAAATAAAGTTCTCTTTTTCAGG - Intronic
1124177952 15:27443617-27443639 GAAATAAAATGCAGGTGTTTTGG - Intronic
1124516217 15:30369264-30369286 GAAATAAATGTCTGTTGCTTAGG + Intronic
1124726703 15:32161467-32161489 GAAATAAATGTCTGTTGCTTAGG - Intronic
1125027735 15:35047371-35047393 GAAATAAATTTTTCTTCTTTGGG - Intergenic
1125119372 15:36135756-36135778 GCAATACATTTCTGTTATTTAGG - Intergenic
1125153857 15:36563945-36563967 GAAATAAATGTTTGTTGTTTAGG + Intergenic
1126277635 15:46902871-46902893 AACATAAATTTATGTTGTTTAGG + Intergenic
1126347935 15:47716633-47716655 GAATTAAAATCCTCTTGTTTTGG + Intronic
1126555002 15:49976930-49976952 GAAATGAATTCCTATTGCTTTGG + Intronic
1127059517 15:55167891-55167913 TAAATAAATTTCTTTTTTTTTGG - Intergenic
1127200250 15:56638638-56638660 TCACTAAATTTCTGTTGCTTTGG + Intronic
1127206485 15:56725340-56725362 GAAAAAAATTTCTCAGGTTTGGG - Intronic
1127382828 15:58444486-58444508 AAAATACATTTCTGTTGTTGAGG - Intronic
1128023644 15:64415401-64415423 ATAATAAATTTCTGTTGTTTAGG - Intronic
1128649789 15:69402137-69402159 AAAATAAATTTCAGTTGTTTAGG - Intronic
1129654298 15:77513504-77513526 GAAATAAATGTCTGTTGTTTAGG - Intergenic
1129993142 15:79982093-79982115 GAAATGAGTTTCTGTGGTTGGGG - Intergenic
1130013073 15:80167187-80167209 GGGATAAATTCCTGTTGTTGTGG - Intronic
1130171413 15:81518715-81518737 AAAATAAATTTCTGTTATTTAGG - Intergenic
1130619174 15:85443539-85443561 GAAATAAATTTCTGGCGATATGG + Intronic
1130877303 15:88025717-88025739 ATAAAAAATTTCTGTTGTTTGGG + Intronic
1131042084 15:89278905-89278927 GAAATCCATTTATGTTGTCTGGG + Intronic
1131136269 15:89938464-89938486 GAATTAACTTTCTGCTCTTTAGG + Intergenic
1131529838 15:93181659-93181681 AAAATACATTTCTGTTGTTTAGG + Intergenic
1131550894 15:93355962-93355984 AAAATAAACTTCTGTTGGTTAGG - Intergenic
1131683481 15:94747855-94747877 GAAATAAACCTCTCTTCTTTGGG - Intergenic
1131968923 15:97873326-97873348 GAAATAAAGTTGTGTTGGTTAGG - Intergenic
1132002285 15:98192440-98192462 GAAATGAACTTCTGCTGTTTCGG - Intergenic
1132275568 15:100560418-100560440 AAAACAAATATCTGTTGATTTGG + Intronic
1132446827 15:101930682-101930704 GACATTAATTGCTTTTGTTTTGG - Intergenic
1132914331 16:2334501-2334523 AAAAAAAATTACTGGTGTTTGGG - Intronic
1133205519 16:4231015-4231037 AGAATAAATTTCTGTGGTTTTGG + Intronic
1135069028 16:19336171-19336193 TAAATAAATGTCTGTTGCTATGG - Intergenic
1135823924 16:25709458-25709480 GAAACAGACATCTGTTGTTTTGG - Intronic
1135893486 16:26377587-26377609 GAAATAAATCTCTGCTCTTAGGG - Intergenic
1135974453 16:27098608-27098630 AAAATAAATTTCTGTTGGCTGGG - Intergenic
1137063866 16:35816100-35816122 CAAATAAATATCTCTTCTTTTGG + Intergenic
1137073266 16:35928397-35928419 GAAACAACTTTCTGATTTTTTGG - Intergenic
1137316447 16:47328997-47329019 TAAATACGTTTCTGTTCTTTTGG - Intronic
1137342481 16:47622972-47622994 GTAATAAATTTTTGTTTTTAAGG + Intronic
1137573749 16:49584544-49584566 AAGATAAATTTCTGTTGCTTAGG - Intronic
1137730267 16:50684361-50684383 GAAAGAGATGTCTGTTGTTTAGG - Intergenic
1137884082 16:52083838-52083860 AAAAAAAATTTCTGTTTATTTGG + Intergenic
1138187652 16:54988667-54988689 GAAATAAATCCCTGTTGTTTGGG - Intergenic
1138593739 16:58018147-58018169 AAAATAAATTTCTGTTATTTAGG - Intronic
1138694668 16:58801451-58801473 GAAATAAATTTCTGTTCTTTAGG + Intergenic
1139070664 16:63377839-63377861 GAAATCAATTTCTTTTATTTGGG + Intergenic
1139080922 16:63519984-63520006 AAAATAAATTTTTGTTTTTTTGG - Intergenic
1139120392 16:64009313-64009335 GAAATCAATTTCTGTTGTTTAGG + Intergenic
1139994078 16:70963591-70963613 AAAAGAAACTTCTGTTGGTTAGG + Intronic
1140226334 16:73080400-73080422 GAAATAAATGTCTGTTGATTGGG + Intergenic
1140772324 16:78216407-78216429 ACAATACATTTGTGTTGTTTAGG - Intronic
1140966707 16:79973336-79973358 AAAACAAATGTCTGTTGTTCAGG + Intergenic
1141072355 16:80969351-80969373 GCAGTGAATATCTGTTGTTTTGG - Exonic
1141187260 16:81796844-81796866 GAGACAAACTTCTGTTGTTTCGG + Intronic
1141222761 16:82086781-82086803 AAAATAAATTTGTGTTGTTTAGG - Intronic
1141327073 16:83070881-83070903 TAAATAAACTCCTGTTGTTTAGG - Intronic
1142772392 17:2107870-2107892 GAAATAAAATTCTGCTGTCCTGG - Intronic
1143013771 17:3880895-3880917 GAAATATATATTTCTTGTTTTGG + Intronic
1143049976 17:4117177-4117199 GAAATCCATTTTTGGTGTTTTGG + Intronic
1143718743 17:8795546-8795568 GAGACAAATCTCTATTGTTTAGG + Intergenic
1144047933 17:11470153-11470175 GGAATAAATATCTGTTGTTTAGG + Intronic
1144078466 17:11740333-11740355 GAAATAAATGTCTGCTGTTTAGG - Intronic
1144166798 17:12619845-12619867 GAAAAAATGTTCTGTTTTTTAGG + Intergenic
1144282891 17:13744635-13744657 AAAATAAATTTCTGTTGTTGAGG - Intergenic
1144308260 17:13988933-13988955 GAAATATATGTTTGTTGTTGAGG + Intergenic
1144334373 17:14255790-14255812 AAAATACATTTCTGTGGCTTAGG - Intergenic
1144613295 17:16744933-16744955 GAACAAAATTTCTGTTATTTGGG + Intronic
1145132958 17:20375009-20375031 GAACAAAATTTCTGTTATTTGGG + Intergenic
1145299165 17:21618838-21618860 GAAAAAAAATTCTGTTTATTGGG + Intergenic
1146396100 17:32468406-32468428 GAAATAAATCCCTGTGGCTTTGG - Intronic
1147641874 17:42007522-42007544 GAAAAAAATTTCTTTTTTTTTGG + Intronic
1148316821 17:46708350-46708372 CAAATTATTTTCTGTTTTTTTGG + Intronic
1148588154 17:48795724-48795746 TCAATAAATATCTGTTGATTTGG + Intronic
1149161220 17:53695344-53695366 GAAATGATTTTTTGTTCTTTTGG + Intergenic
1149209566 17:54287926-54287948 GAAAAAACTTCCTGTGGTTTTGG - Intergenic
1149269845 17:54966476-54966498 TGAATAATTTTTTGTTGTTTGGG + Intronic
1149325297 17:55523666-55523688 AAAATAGGTTTCTGCTGTTTAGG + Intergenic
1149443701 17:56697447-56697469 GAAATAAATTTCTGTTGTCTAGG - Intergenic
1149622023 17:58052708-58052730 GTAATAAATATTTGTTGTTTGGG + Intergenic
1149927162 17:60712891-60712913 GAAACAATTTTCTGCTCTTTGGG - Intronic
1150015333 17:61551444-61551466 GAAAATAATTTCTGTACTTTGGG - Intergenic
1150119597 17:62589657-62589679 GAAACCAATTTCTCTTGTTGAGG - Intronic
1150243773 17:63658216-63658238 GAATCAAATTTCTCTTGTTGGGG - Intronic
1150455252 17:65302121-65302143 AAAAGAAATTTCTGTTGTTGAGG - Intergenic
1150803261 17:68298665-68298687 ACAATAAATTTCTGTTGTTTGGG - Intronic
1150950663 17:69799916-69799938 AAAAAAAATTTCTGTTGCATAGG + Intergenic
1151003835 17:70410874-70410896 AAAATATTTTTCTGTTGTTTAGG + Intergenic
1151644704 17:75422354-75422376 AAAATAAAATACTGATGTTTAGG - Intergenic
1151681920 17:75626874-75626896 GGAATAAAGTTGTGTTGTTGTGG - Exonic
1151921178 17:77156954-77156976 AAAATAAATTTATGTTCTGTAGG - Intronic
1151981818 17:77516176-77516198 CAAAGAAATGTTTGTTGTTTTGG - Intergenic
1152248272 17:79197692-79197714 GAAAGAAATATCTGTTTTCTGGG - Intronic
1152673270 17:81622290-81622312 TCATTAAATTTCTGTTCTTTGGG - Intronic
1152991785 18:370328-370350 GAAATAAAATTCGTTTCTTTGGG - Intronic
1153269716 18:3308050-3308072 CAAATAAATATTTGTTGTTGTGG - Intergenic
1153296445 18:3551082-3551104 AAAATAAATTTCTGTTGTTTAGG + Intronic
1153606881 18:6843044-6843066 GAAATAAATTACAGTTCTTCAGG - Intronic
1153684472 18:7531794-7531816 TCAATACATTTGTGTTGTTTAGG - Intergenic
1153926834 18:9842031-9842053 GACATACAGTTCTGTTGTTATGG + Intronic
1154389622 18:13925091-13925113 GGAGTAACTTTCTTTTGTTTAGG - Intergenic
1154481946 18:14838026-14838048 GAAAATAATTTCTTTTTTTTTGG - Intronic
1155133504 18:22963039-22963061 TGAATAAATGTCTGTTCTTTTGG - Intronic
1155389034 18:25313656-25313678 AAAATAATTTTATGTTATTTTGG - Intronic
1155455006 18:26002390-26002412 TAAGTAAATTACTGTTATTTGGG - Intergenic
1155471929 18:26200649-26200671 GAAATAAACTTCCATTGTGTAGG - Intergenic
1155769644 18:29680800-29680822 GAAATAAATTGTTATTGTTTTGG - Intergenic
1155804329 18:30146751-30146773 TAAATCCATTTCTGTTTTTTAGG - Intergenic
1155859516 18:30879442-30879464 GAAAAAAATATCTGATGTCTGGG + Intergenic
1156200575 18:34827025-34827047 GAAGTTAGTTTCTGTTGTTTGGG - Intronic
1156399742 18:36729481-36729503 GAAATAAATTTCTGCTGTTTAGG - Intronic
1156413055 18:36854283-36854305 GAAATAAGTTTCAGTTGTTCAGG + Intronic
1156560712 18:38122390-38122412 GCAATAAATATCTGTTGAATGGG - Intergenic
1156601047 18:38607373-38607395 GATTTAAATTTCTGCTGTTCCGG - Intergenic
1157847669 18:51018551-51018573 GAAATAATTTGGTGGTGTTTAGG + Intronic
1158082648 18:53612369-53612391 GAAATAAAGGAATGTTGTTTTGG + Intergenic
1158100647 18:53825900-53825922 GAAAGTATATTCTGTTGTTTTGG - Intergenic
1158241139 18:55379784-55379806 GAAGTAAATGCTTGTTGTTTAGG - Intronic
1158512864 18:58106957-58106979 TAAATAAATGTCTGAGGTTTTGG - Intronic
1158571151 18:58598030-58598052 GAAAGAAACTTCTGTTGTTTAGG + Intronic
1158746727 18:60208528-60208550 GAAATAAGTTTGTCTTGGTTTGG + Intergenic
1158797397 18:60863641-60863663 AAAATAAATTTATGTTATTTAGG + Intergenic
1158848239 18:61467348-61467370 GAAACATATTTATGGTGTTTGGG + Intronic
1159131534 18:64285926-64285948 GAAATAAAGTTCCCTTGTGTGGG + Intergenic
1159138448 18:64364370-64364392 TTATTAAATGTCTGTTGTTTTGG - Intergenic
1159303358 18:66606894-66606916 AAAATATATTTAAGTTGTTTTGG + Intergenic
1159666470 18:71167380-71167402 GAAATAATCTTCTGTGATTTTGG + Intergenic
1160124464 18:76157691-76157713 AGAATAAATTTCTGTTGTATAGG + Intergenic
1160172628 18:76567608-76567630 GGAATAAATTCCTCTTGTTTAGG - Intergenic
1160463265 18:79055352-79055374 GGAATAAATTCATGTTGTTTAGG - Intergenic
1160638392 19:101535-101557 GACATTAATTGCTTTTGTTTTGG + Intergenic
1162977947 19:14219415-14219437 GCGACAAATTTCTGTTGTTAGGG + Intergenic
1163112340 19:15169369-15169391 AAAATTAATTTCTGTTGTTTAGG + Intronic
1163553159 19:17977045-17977067 ACAATACATTTCTGCTGTTTTGG - Intronic
1165102203 19:33445641-33445663 AAAACACATTTCTGTTGCTTAGG + Intronic
1165330195 19:35137337-35137359 TAAATACATATCTGTGGTTTTGG + Intronic
1165704664 19:37967007-37967029 ATAATAAATTTCTGTTGTTTAGG - Intronic
1166655156 19:44605826-44605848 GAGACAAGTTTCTGTTGTATGGG + Intergenic
1168264985 19:55217907-55217929 AAAACAAATCTCTGCTGTTTGGG - Intergenic
1168312917 19:55470252-55470274 AAAATAAGTTTCTGTTGTTGGGG + Intergenic
1168476342 19:56678150-56678172 AGAATAAGTTTCTGTTGTTTAGG + Intergenic
1168630853 19:57954999-57955021 GAAATACATGTTTGTTGTTTAGG + Intergenic
924981473 2:226412-226434 CATATAAATTGCTGGTGTTTTGG - Intronic
925309389 2:2871535-2871557 GAAATATATGAATGTTGTTTTGG - Intergenic
925367083 2:3317914-3317936 GAAATTAACTTCTGTTGCCTGGG + Intronic
925502769 2:4524437-4524459 GAAAAAAAGTTCTGTTTTCTTGG - Intergenic
925620197 2:5784655-5784677 AAAATAAATTTCTGTTGTTTAGG - Intergenic
925747913 2:7059916-7059938 AAAATAAAGTTATGTTGTTGTGG + Intronic
925759168 2:7167655-7167677 GAGATAAATTTCTGATGTCATGG - Intergenic
925818638 2:7777728-7777750 GAAATGAATTACTATTGTTTAGG - Intergenic
926281146 2:11447441-11447463 TAGTTAAATTTCTGTAGTTTTGG - Intronic
926928325 2:18010827-18010849 GAGATAATTTTTTGTTCTTTTGG + Intronic
927061005 2:19419315-19419337 GAAATAACTTTCTGGAGATTGGG - Intergenic
927091066 2:19713083-19713105 GAAATATATTTCTGTGATGTGGG - Intergenic
927327345 2:21820367-21820389 GAAATAAATTTCTGTTGTTTAGG - Intergenic
927800688 2:26096106-26096128 GAAATAAGTTTCAGTTTATTGGG + Intronic
927915370 2:26932616-26932638 GAACTGACTTTTTGTTGTTTGGG - Intronic
928214634 2:29351202-29351224 GAAAAATACTTCTGTTCTTTTGG + Intronic
928302483 2:30138382-30138404 ATAATAAATTCATGTTGTTTTGG - Intergenic
928523600 2:32116458-32116480 GATATAATTTTGTTTTGTTTTGG + Intronic
928809191 2:35200961-35200983 AAAATAAATTTCTGTTAATATGG - Intergenic
928857683 2:35818823-35818845 GAAATAAATGTGTGTTATTTAGG + Intergenic
929041938 2:37753072-37753094 AAAATTAAATTCTGTTGTTCAGG - Intergenic
929297552 2:40265682-40265704 GAAATGAATTACTGCTCTTTTGG - Intronic
931138372 2:59429990-59430012 AAAAAAATTTTCTGTTATTTAGG - Intergenic
931279003 2:60771782-60771804 CAAATAAATTTGTGGTTTTTAGG - Intronic
931536838 2:63286947-63286969 AAAATAAATTTCTGTTGTTTAGG - Intronic
931985317 2:67736219-67736241 AAAATAAACTTCTGTTATTTAGG - Intergenic
932202295 2:69841194-69841216 GTAATAAATTGCTTTTGGTTAGG - Intronic
932530769 2:72529602-72529624 GAAAGAAGTTTCTGTTTCTTTGG + Intronic
932561368 2:72873551-72873573 AAAATAAATGTCTGTTGTTTAGG + Intergenic
932743433 2:74310270-74310292 GAAATAAATGTATATAGTTTGGG - Intronic
933028571 2:77295573-77295595 AAAATACATTTCTGCTGTTGAGG - Intronic
933298827 2:80520465-80520487 GAAACACATTTCTGTTGTTTAGG - Intronic
933313054 2:80684561-80684583 ACAATAAGTTTCTCTTGTTTTGG - Intergenic
933356740 2:81219738-81219760 TAAATAAATTTTTGTTTATTTGG + Intergenic
933512627 2:83260516-83260538 GAATTGTATTTCTGTTGTGTTGG - Intergenic
933912766 2:86958021-86958043 GACTTAAATTTCTTTTATTTAGG + Intronic
934010229 2:87811869-87811891 GACTTAAATTTCTTTTATTTAGG - Intronic
934864653 2:97795861-97795883 GAAACAAATCTCTGTTGCTGAGG + Intronic
934961635 2:98680942-98680964 GAATTGAATTTCTTTTGCTTAGG - Intronic
935034338 2:99354015-99354037 AACATAAATTTTTGTTATTTAGG + Intronic
935040554 2:99422538-99422560 GAAATAAGTATGTTTTGTTTAGG + Intronic
935448732 2:103185852-103185874 GAAATAAATGCCTGTTGTTTAGG + Intergenic
935454491 2:103251448-103251470 TAAATAATATTCTATTGTTTGGG + Intergenic
935773794 2:106452589-106452611 GACTTAAATTTCTTTTATTTAGG - Intronic
935797566 2:106659662-106659684 GAAATGAATTCCTAGTGTTTAGG + Intergenic
935886821 2:107629701-107629723 GAAAAATATCTCAGTTGTTTGGG - Intergenic
935906269 2:107843324-107843346 GACTTAAATTTCTTTTATTTAGG + Intronic
935934203 2:108164232-108164254 AAAATATATTTCTTTTCTTTTGG - Intergenic
936020851 2:108993842-108993864 GAAACAAATGTCTGTTGTTGAGG - Intergenic
936105437 2:109620307-109620329 GGAATAACTTGCTGTTCTTTTGG - Intergenic
936675963 2:114714294-114714316 GAAATTAATTTCTACTTTTTGGG - Intronic
936750098 2:115631874-115631896 GAATTTATATTCTGTTGTTTTGG + Intronic
937022954 2:118675297-118675319 TAGAAAAATTTCTGTTGGTTCGG + Intergenic
937484710 2:122302888-122302910 GAATGTATTTTCTGTTGTTTTGG - Intergenic
937510569 2:122590319-122590341 AAAACAAATTTCTGTTGTTTAGG + Intergenic
937901548 2:127023540-127023562 GAAATAAATTCTTGTTGTTTAGG - Intergenic
937946100 2:127338921-127338943 AAAATAAATACCTGTTTTTTTGG + Exonic
938095877 2:128463042-128463064 GAAATAAATGTCTGTCATTGAGG - Intergenic
938164828 2:129017458-129017480 AAAACAAATTTCTATTGTATGGG + Intergenic
939030494 2:137069755-137069777 GAAAAAGACTTGTGTTGTTTGGG - Intronic
939333356 2:140791958-140791980 GATATAAATTTCCCTTGTGTAGG + Intronic
939397577 2:141650579-141650601 GAAATAAAAATCTGTTTTTCTGG - Intronic
939794774 2:146629397-146629419 GTAATAAATTTTTGTTGTTTAGG - Intergenic
939918987 2:148085332-148085354 GAACAAAATTTCTCTTGTTTTGG - Intronic
940014241 2:149086699-149086721 AAAATAAATTTTTATTGTTTAGG - Intronic
940164230 2:150751479-150751501 ATAATAAATTTGTGTTGTTTAGG - Intergenic
940467282 2:154046901-154046923 AAAATATATTTCTGTTGTTTAGG + Intronic
940496386 2:154434146-154434168 GAAATAAATTTCTGTTGCTTAGG + Intronic
940754235 2:157663469-157663491 GAATTAAATTTGTGTTGCTTTGG + Intergenic
940896713 2:159088099-159088121 AAAGTAAACTTCTGTTGTTTAGG + Intronic
941086394 2:161123053-161123075 AAAACAAAGTTCTCTTGTTTAGG - Intergenic
941086538 2:161124546-161124568 AAAATAAATTTCTGTTGTTTAGG + Intergenic
941135080 2:161705751-161705773 GAAATAAATATTTGTTGTTGTGG + Intronic
941180721 2:162256058-162256080 AAAATTAATTTCTGTTGTTCAGG - Intergenic
941306524 2:163875771-163875793 CAATTATATTTGTGTTGTTTAGG - Intergenic
941641971 2:167998520-167998542 GAAATATATTTCATCTGTTTTGG + Intronic
941677464 2:168358942-168358964 GAAATAAATTTCTGTAGTTTGGG + Intergenic
941939426 2:171018307-171018329 AGAATACATTTCTGTTGTTTAGG + Intronic
942099652 2:172567293-172567315 TAAATAATTTTCTGTTGTTGAGG + Intronic
942128461 2:172851399-172851421 GAATGTAAGTTCTGTTGTTTTGG + Intronic
942320864 2:174734595-174734617 ACAACACATTTCTGTTGTTTAGG + Intergenic
942776401 2:179587625-179587647 GAGGCTAATTTCTGTTGTTTAGG + Intronic
943101767 2:183495635-183495657 GAAAAACATATCTGTTCTTTTGG + Intergenic
943720465 2:191198714-191198736 TAAATGAATTTCTGTTGTTTAGG - Intergenic
943744487 2:191447512-191447534 GAAATACACTTCTGGAGTTTGGG - Intergenic
944352673 2:198747217-198747239 GAGATAAATTTCTATTGCTAAGG + Intergenic
944577089 2:201100251-201100273 GAAATAAATTTCTGATCATGTGG - Intergenic
944623786 2:201548197-201548219 GAAATAAATGTATATTGTTTGGG - Intronic
944875115 2:203956052-203956074 CAAATAAATATCTTTTGTGTTGG + Intronic
944956700 2:204820375-204820397 TACATAAAAATCTGTTGTTTAGG - Intronic
945337258 2:208606846-208606868 ATAATACATTTCTATTGTTTAGG + Intronic
945548337 2:211186865-211186887 GAAATTACTGTCTGTTGGTTCGG + Intergenic
945558358 2:211307030-211307052 GAAATAAGTTTCACTTGTGTAGG - Intergenic
945584944 2:211649426-211649448 GAAATAAAAAACTGATGTTTTGG + Intronic
945590452 2:211722600-211722622 GAAAAAAACTTCTCCTGTTTTGG - Intronic
945698972 2:213147323-213147345 GAAATAATTTTATGTTGCCTTGG - Intronic
945951677 2:216044799-216044821 GAAATAACTTCCTTCTGTTTGGG - Intronic
946445584 2:219737421-219737443 GAAGCACATTTCTGTTCTTTGGG - Intergenic
946501800 2:220257148-220257170 AAAATAAATTTCTGTTATTTAGG - Intergenic
946625688 2:221610253-221610275 AATATAAATTTCTGTGGTCTAGG - Intergenic
946654612 2:221932977-221932999 AAAATAGATTTATGTTGTTTAGG - Intergenic
947067996 2:226252053-226252075 GTAATAAATTTCTACTGTCTTGG - Intergenic
947654315 2:231813261-231813283 AAAAGAAAATTCTGTTGCTTGGG - Intergenic
947887674 2:233587383-233587405 GATTGAAATTTCTGTTGTGTTGG + Intergenic
947950464 2:234142658-234142680 AAGATAAACTTCTGTTGTTTAGG + Intergenic
948043910 2:234928173-234928195 AAAATAAATTTCTGTTGTTTAGG + Intergenic
948102924 2:235389796-235389818 GAAACCAGTTTCTGTTGTTTCGG - Intergenic
948162806 2:235839018-235839040 GAGATAAATTGCTGGTGTGTTGG + Intronic
1169408497 20:5346915-5346937 GAAATAAATTTCTGTTGTTTAGG - Intergenic
1169572036 20:6916943-6916965 GAAATAAATTCCTTTTCTTCTGG - Intergenic
1170412879 20:16109298-16109320 AAAAGAAATTTCTCTTTTTTAGG + Intergenic
1170743594 20:19079014-19079036 GAAATACATTTCTGCTGTTTGGG + Intergenic
1170794930 20:19538767-19538789 TATATGAATTTCTGTTGATTCGG - Intronic
1170966347 20:21075473-21075495 GAAATAAACTTCTATTGTTTAGG - Intergenic
1171105236 20:22427005-22427027 GAAATAAATGTCTATTGTTTAGG + Intergenic
1172476166 20:35239487-35239509 GAAATAAACATTTGATGTTTAGG + Intronic
1173435380 20:43027704-43027726 AAAATACATTTCTGTTGTTTAGG + Intronic
1173461897 20:43249556-43249578 GAAATACATTTCTATTGGATTGG - Intergenic
1173715955 20:45206152-45206174 AAAAGAAAATTCTGCTGTTTAGG + Intergenic
1173955659 20:47030601-47030623 AAAATAAAGTTCTGTTGTCTAGG - Intronic
1174384415 20:50178595-50178617 AGAATAAATTTCTGTTGTTTTGG + Intergenic
1174902368 20:54513921-54513943 GAGAGAAATTTGTGTGGTTTTGG + Intronic
1175616721 20:60406031-60406053 ATAATAAATGTCTGTTGTTTTGG + Intergenic
1175670515 20:60899008-60899030 CATATAAATTTCTGTGTTTTTGG - Intergenic
1176798661 21:13398595-13398617 GAAAATAATTTCTTTTTTTTTGG + Intergenic
1176924744 21:14734312-14734334 CAGATAAATTTCTGTTCTTGGGG + Intergenic
1177023561 21:15893867-15893889 GAAATAATTTTTTTTTTTTTTGG - Intergenic
1177492948 21:21852060-21852082 ACTATAAATTTCTGTTATTTGGG - Intergenic
1177966918 21:27739172-27739194 ATAATAAATTTCTGTTGTTTTGG - Intergenic
1178304607 21:31481048-31481070 AAAATAAATGTCTGTTGGCTGGG - Intronic
1178386352 21:32153837-32153859 GATAAAAATTTCTGGTTTTTAGG + Intergenic
1178429379 21:32505609-32505631 AAAATCAATGTCTGTTATTTAGG - Intronic
1179155105 21:38842934-38842956 GAAATAAATGTCCGTTGTTTAGG + Intergenic
1180630294 22:17224761-17224783 GATATAAGTTGCTGATGTTTGGG - Intergenic
1180893669 22:19311179-19311201 GAAATAAATATCTGTGGTAAAGG - Intergenic
1181293478 22:21816322-21816344 GAAATACATTTCTTTTGGTCTGG - Intronic
1181341505 22:22183676-22183698 GAAATAAAATTCTGACATTTAGG - Intergenic
1181887422 22:26032264-26032286 GAAATAAATTTCTGTTGTTTAGG - Intergenic
1182382290 22:29901885-29901907 GTAATTACTTTCTGTTGTTTAGG + Intronic
1182465498 22:30513697-30513719 AGAATAAAATTCTGTTGTTCAGG + Intergenic
1182677737 22:32053004-32053026 GAGAAAAATTGTTGTTGTTTAGG + Intronic
1182921661 22:34085684-34085706 AAAATAAACGTCTGTTGTTTAGG - Intergenic
1182927081 22:34135034-34135056 AAAATAAATTTTTGTTGTTTAGG - Intergenic
1183631289 22:39034444-39034466 GAAATAAATGCCTGCTGTGTGGG - Intergenic
1183824494 22:40374579-40374601 GCAATAAATATCTGTTGAATGGG + Intronic
1184609940 22:45596999-45597021 GAAATAGATCTCTTTTTTTTTGG + Intronic
1184724758 22:46337108-46337130 TCATCAAATTTCTGTTGTTTTGG + Intronic
1184989459 22:48157125-48157147 AAAATAAACGTCTGCTGTTTGGG + Intergenic
1185163851 22:49245616-49245638 GAAATTAATTCCTGTTGTTTAGG - Intergenic
1203294150 22_KI270736v1_random:24590-24612 AAAATTAAATTCTGTTGTTCAGG - Intergenic
949237161 3:1823157-1823179 AAAATAAATTTCTATTGTTTAGG + Intergenic
949264459 3:2140408-2140430 GAAATAAATTTCTGTTGTTTAGG - Intronic
949327136 3:2879380-2879402 AGAATAAATTTCTTTTGCTTAGG + Intronic
949637022 3:5994273-5994295 GAAATATATTTTTGGTCTTTGGG - Intergenic
949746328 3:7297446-7297468 TAAATGCATTTCTGTTGTGTGGG + Intronic
949859486 3:8492425-8492447 GGAATCAATTTCTGTAGCTTGGG - Intergenic
951045693 3:18035643-18035665 CAAATGCATTTCTGTTGTCTAGG + Intronic
951290792 3:20869971-20869993 GAATTAAATTTTTTTTTTTTTGG + Intergenic
951456531 3:22898358-22898380 ACAATAAATTTCTATTGTTTGGG + Intergenic
951905277 3:27700228-27700250 GACATATATTTTTGTTATTTTGG + Intergenic
952179328 3:30901632-30901654 GAAATAAATCTTAGTTGATTTGG - Intergenic
952611302 3:35213819-35213841 AAAATAAATTTCTATTGTTTAGG + Intergenic
952753289 3:36843106-36843128 AAAATACATCTCTGTTGTTTAGG + Intronic
952851791 3:37735358-37735380 GACAGAAATTTCTGTTGCTGTGG - Intronic
953086573 3:39674164-39674186 GATGATAATTTCTGTTGTTTAGG - Intergenic
953286251 3:41612575-41612597 GAAATTAATTTGTATTATTTTGG - Intronic
953610447 3:44443418-44443440 TAAAATAATTTCTGTTCTTTTGG + Exonic
953657951 3:44868662-44868684 AAAATAAATATCTGTTGTTTAGG + Intronic
954307875 3:49740019-49740041 AAAATAAAATTGTGGTGTTTGGG + Intronic
954785205 3:53087520-53087542 GAAATAATTTTTTTTTTTTTTGG + Intronic
955527134 3:59832681-59832703 GAAATAAATATTTGTTTATTTGG + Intronic
955712109 3:61791317-61791339 GAAATAAGTTTCTGTTGCAACGG + Intronic
956281345 3:67560363-67560385 ACAATCAATTTCTGTTGTTCAGG + Intronic
956453173 3:69394092-69394114 GAAATAAATTTCTGTTGTTTAGG - Intronic
956474680 3:69607774-69607796 GGACGAAATTTCTGTTGCTTAGG - Intergenic
956577917 3:70775937-70775959 GAAATATATTACTGAAGTTTGGG - Intergenic
957046859 3:75382454-75382476 AAAATCAATGTCTGTTATTTAGG + Intergenic
957249924 3:77759413-77759435 GAATGTAATTTCTGTTGATTTGG - Intergenic
957389658 3:79547769-79547791 GAGATAAATTTCTATTTTCTTGG - Intronic
957443143 3:80279208-80279230 GAAATAGGTTTTTGTAGTTTTGG - Intergenic
957443152 3:80279355-80279377 AAAATAAAGCTCTGCTGTTTTGG + Intergenic
957654087 3:83049294-83049316 GCAATAAATTTTTGTAGTTTAGG + Intergenic
957707075 3:83802718-83802740 GCATTAAAAATCTGTTGTTTCGG + Intergenic
957774990 3:84746512-84746534 GAAATAAAATTAACTTGTTTAGG - Intergenic
957821743 3:85385323-85385345 GAAAAAAATATATGTTGTTTGGG + Intronic
957918713 3:86720606-86720628 AAAACAAATTCCTGTTGTTTAGG + Intergenic
958128900 3:89391902-89391924 AAAATACATTTTTGTTGTATTGG - Intronic
958144744 3:89609640-89609662 GTAGTAAAATTCAGTTGTTTAGG + Intergenic
958478055 3:94610338-94610360 GAAATAAAGTACTTTTGTTAAGG + Intergenic
959134803 3:102404272-102404294 GATATACATTACTGTTCTTTTGG + Intronic
959154678 3:102652589-102652611 GAAATAGATGGCTTTTGTTTTGG + Intergenic
959287814 3:104439364-104439386 GAAACAAAGTTCAGTTATTTAGG - Intergenic
959347174 3:105211791-105211813 GAAATATATTTGTCTGGTTTTGG + Intergenic
959383327 3:105669454-105669476 GATATAAATGTTTGCTGTTTAGG + Intronic
959500247 3:107098673-107098695 AAAATAAATGTCTGTTGTTCTGG + Intergenic
959677085 3:109048591-109048613 TAAATAAACTTCTGTTGTTTAGG - Intronic
960040035 3:113141337-113141359 GAAATAAAATTATGTCATTTTGG + Intergenic
960265827 3:115619797-115619819 AAATTACATTTCTGTTTTTTAGG + Intergenic
960471737 3:118074903-118074925 GAGAGAGATTTCTTTTGTTTAGG - Intergenic
961266851 3:125650040-125650062 GAAATACATTTCTGTTGTTTAGG + Intergenic
961421623 3:126810130-126810152 GAAATTAAATTTTGTTCTTTTGG - Intronic
961423867 3:126829800-126829822 GAAATAAATGTTTGTTGGCTGGG + Intronic
961568015 3:127777385-127777407 AACAGAAGTTTCTGTTGTTTGGG + Intronic
962599757 3:136982822-136982844 GAAATAAATAACTTTTCTTTTGG + Intronic
962694916 3:137938562-137938584 AAAATAAATTTCTATTGTTTAGG + Intergenic
963367661 3:144358620-144358642 GAAAAAAATTTCTGTTTTTAAGG + Intergenic
963391014 3:144664446-144664468 ACAATACATTTCTGTTATTTTGG + Intergenic
963438314 3:145301702-145301724 GAAAGAAATTTCTGTTAATTAGG - Intergenic
963563393 3:146896497-146896519 GTAACAAATATCTATTGTTTGGG + Intergenic
964034706 3:152181602-152181624 CAAACATGTTTCTGTTGTTTTGG - Intergenic
964291864 3:155189929-155189951 AAGATAAGTTTGTGTTGTTTGGG + Intergenic
964292811 3:155200097-155200119 GAGATAATTTTCTGTTGTTTAGG + Intergenic
964366818 3:155959212-155959234 TAAATAAATTTCTCTGGTTAGGG - Intergenic
965040846 3:163505077-163505099 GAAATAAATTTCTGTTGTTCAGG - Intergenic
965098858 3:164271623-164271645 AAAATAAATGGCTATTGTTTAGG + Intergenic
965418298 3:168425172-168425194 TAAATAAATTTCTGTTGTGTAGG + Intergenic
965810118 3:172583031-172583053 GAAATAAATTTCTGTTATTTTGG - Intergenic
965926500 3:173986643-173986665 ATAATAAATTTCTGTTCTTTAGG + Intronic
966003516 3:174979704-174979726 GCAATATTTTTCTGTTTTTTAGG - Intronic
966454410 3:180098978-180099000 GAAAGAAATTTCTGCAATTTGGG - Intergenic
966702892 3:182875897-182875919 GCAATTAATTTCTGTGTTTTAGG - Intronic
968991152 4:3913569-3913591 AAAATCAATGTCTGTTATTTAGG + Intergenic
969127819 4:4966684-4966706 GAAATACACTTCTATTGTGTTGG + Intergenic
969433524 4:7170106-7170128 TAAATACATGTCTGTTGTTTAGG - Intergenic
969651530 4:8471034-8471056 GTAATATTTTGCTGTTGTTTTGG + Intronic
969824191 4:9743964-9743986 AAAATCAATGTCTGTTATTTAGG - Intergenic
970009465 4:11443358-11443380 GAAAGAAATATCTGAGGTTTGGG + Intergenic
970114100 4:12673647-12673669 CAAATAAATGATTGTTGTTTAGG + Intergenic
970260380 4:14218059-14218081 AAAATAAATTTCTGTCATTTAGG + Intergenic
970261514 4:14229881-14229903 AAAATGAATTTCTATTGTTTAGG - Intergenic
970551467 4:17185914-17185936 AAGATAAATTTCTGTCGTTTAGG - Intergenic
970584331 4:17500680-17500702 AAAATAAATCTCTGTTGTTTAGG + Intronic
970754715 4:19411600-19411622 TAAATACTTTTCTATTGTTTAGG + Intergenic
970892237 4:21059944-21059966 AAAATATATTTATGTTGTTATGG - Intronic
970897838 4:21123943-21123965 AAAATAAATGTCCGTTGCTTAGG + Intronic
970944876 4:21679135-21679157 AAAACAAATTTCTGTTGTTTAGG + Intronic
971005264 4:22366883-22366905 GGAATAAATCTCAGTTGTTTTGG - Intronic
971162827 4:24151232-24151254 TAAATAAATTTCTGTTGTTTAGG - Intergenic
971368515 4:25996210-25996232 TAAATAAATTAATGTTGTATAGG - Intergenic
971439549 4:26665613-26665635 AAAATTAATTTAAGTTGTTTTGG + Intronic
971603144 4:28622014-28622036 GGAATAAATTTTTGTGCTTTGGG + Intergenic
971615235 4:28780823-28780845 GAAATACATATCTTTTGTCTGGG - Intergenic
971769244 4:30875096-30875118 AAAATAAATTCATGTTGTTTAGG - Intronic
972146990 4:36039950-36039972 GAAATAAACTTTTTTAGTTTAGG + Intronic
972240223 4:37182925-37182947 GAAAATATTTTCTGTTGATTAGG - Intergenic
972245267 4:37240646-37240668 GAAATAAATTTGTTCTGTTATGG - Intergenic
972410963 4:38794088-38794110 GGAATAAATTTCAGTTGTTTAGG + Intronic
972523922 4:39889338-39889360 AAAATAAATTTCTTTTGTTCAGG + Intronic
972721591 4:41704674-41704696 TAAATAATTTTCTGTTTTTGGGG - Intergenic
973014986 4:45126828-45126850 AAAATAAATGTTTGTTGTTTAGG + Intergenic
973659928 4:53094282-53094304 GAAATAAATTTCTGTTGTTTAGG - Intronic
974085853 4:57260646-57260668 GAAAGTATATTCTGTTGTTTTGG + Intergenic
974360909 4:60877873-60877895 AAAACAAATTTCTGTTGTTTAGG + Intergenic
974385327 4:61196953-61196975 GAAACAAATTTGTCTTGTTTAGG + Intergenic
974500763 4:62698845-62698867 AAAATAAATTTCTGTTGTGTAGG - Intergenic
974544754 4:63287109-63287131 AAAATAAATTTCTGCCATTTGGG - Intergenic
974640848 4:64628324-64628346 GAAATTAAGGTCTGTTATTTGGG - Intergenic
974681829 4:65174576-65174598 AAAATAAATTTCTGTTTATGTGG + Intergenic
974807830 4:66903620-66903642 GAAATACATTTGTGGTGGTTTGG + Intergenic
975194478 4:71507771-71507793 GAAAGTATATTCTGTTGTTTTGG - Intronic
976182363 4:82410936-82410958 GAAATAAATGTCTGTTGTTTAGG - Intergenic
976304033 4:83541729-83541751 AAAATAAATTTCTGTTGTTTAGG - Intronic
976400287 4:84599066-84599088 GAAATCAATTCCTGTTGTTTAGG - Intronic
976803341 4:89018414-89018436 GAAATAAATTTCTCTCGTTTAGG + Intronic
976920854 4:90441308-90441330 AAAATAAATATCTATTGTTTAGG - Intronic
977111707 4:92964552-92964574 AAAATAAAAATCTGTTGTTTAGG + Intronic
977152602 4:93531983-93532005 GACTTAAACTTTTGTTGTTTGGG + Intronic
977287188 4:95122516-95122538 GAAAAAAATATTTGTTGTTCTGG + Intronic
977482547 4:97596442-97596464 GAAAGTATATTCTGTTGTTTTGG - Intronic
977691208 4:99913513-99913535 GAAATAAACTTCTATTGTTTGGG + Intronic
977725830 4:100296019-100296041 AAAATACACATCTGTTGTTTAGG + Intergenic
977729594 4:100334750-100334772 GAATGAATATTCTGTTGTTTTGG - Intergenic
977901683 4:102429480-102429502 GAATTTATTTTTTGTTGTTTTGG + Intronic
978239193 4:106495038-106495060 AAAATAAATTTCTATTGTTTAGG + Intergenic
978606263 4:110483067-110483089 TAAGTAAATTTCTTTTATTTTGG + Intronic
978636815 4:110819412-110819434 AGAATAAATCTCTGTTCTTTTGG - Intergenic
978823451 4:112992531-112992553 GAAATAAATTTCTGTTTTTTAGG - Intronic
979282312 4:118881471-118881493 AGAATAAACTTCTGTTGCTTAGG + Intronic
979835423 4:125361214-125361236 AAAATATATCTCTGTTCTTTGGG + Intronic
980176084 4:129346409-129346431 GAGACAACTTTCTCTTGTTTTGG + Intergenic
980619863 4:135286640-135286662 AAAATAAATTTCTGTCATTTAGG + Intergenic
980756929 4:137177108-137177130 TAAATAAATGACTGTAGTTTAGG - Intergenic
980905695 4:138946629-138946651 AAAATTAATTTATATTGTTTAGG + Intergenic
981116639 4:140998493-140998515 AAAATAAGTGTCTGTTGTTTAGG + Intronic
981409202 4:144408459-144408481 GAAATAAATTTCAGTGTCTTTGG - Intergenic
981912000 4:149992702-149992724 GATAAAAATGTGTGTTGTTTAGG + Intergenic
982035996 4:151346271-151346293 TAAATAAATCTCAGTTTTTTTGG - Intergenic
982392221 4:154877135-154877157 CTGATAAACTTCTGTTGTTTTGG + Intergenic
982658962 4:158183642-158183664 AAAATAATTTTTTCTTGTTTTGG - Intergenic
982673305 4:158347978-158348000 GCAATAAATTTCTTTTGTCTAGG + Intronic
982677918 4:158397419-158397441 AAAATAAATTTCTATTGTTTTGG + Intronic
982951207 4:161698264-161698286 GAAATAAATGTTTGTTGTTTAGG + Intronic
983053943 4:163080200-163080222 AAAATCAATTTCTGTTGTTTAGG + Intergenic
983078926 4:163361006-163361028 GAAATAAATCTCTGTGACTTTGG - Intergenic
983109346 4:163728769-163728791 GAAACAAAATTATGTTGATTGGG - Intronic
983213896 4:164984816-164984838 GAAATAAATTTCTATTTTTTAGG + Intergenic
983431027 4:167651722-167651744 GAAATAAATTTGTGTTTATGTGG + Intergenic
983780928 4:171669214-171669236 GAAAAAAATTCCTCTTGTTTTGG - Intergenic
983804207 4:171973312-171973334 AAAATACATTTCTATTGTTTTGG - Intronic
983808666 4:172028505-172028527 AAACTAAATTTCTTTTGTGTAGG - Intronic
983982148 4:174011171-174011193 GAAATATATTTCTGTGCATTGGG + Intergenic
984115080 4:175670067-175670089 ACAATGAATTTCTGTTGTTTAGG + Intronic
984259837 4:177431565-177431587 AAAATAAATTTATGTTGAATTGG - Exonic
984476403 4:180241154-180241176 GCAACACATTTCTGTTGTCTAGG - Intergenic
984733661 4:183090945-183090967 AACATAAATTTCTGCTTTTTAGG + Intergenic
984816261 4:183839748-183839770 GAAATATATGTGAGTTGTTTTGG + Intergenic
985218897 4:187681928-187681950 GAAATAAGTATCTGTTCTTTAGG + Intergenic
985285482 4:188332455-188332477 AAAATAGCTTTCTGTTGTCTAGG + Intergenic
985909406 5:2867144-2867166 GAAATAAGTCACTTTTGTTTTGG + Intergenic
985993572 5:3583790-3583812 GCAATAAGTTTCTGTTGTTTAGG + Intergenic
986252115 5:6069641-6069663 GCAATAAAATTCTGTTGTTTAGG + Intergenic
986460013 5:7960484-7960506 AAAATAAATTTCTGCTGTTCAGG - Intergenic
986510247 5:8497781-8497803 GAACTCAGTTTTTGTTGTTTGGG - Intergenic
986558005 5:9030944-9030966 GAAATAGTTTTGTGTTGTTTTGG - Intergenic
986659606 5:10047193-10047215 AAAATAAATGTCTATTCTTTAGG - Intergenic
986760517 5:10875944-10875966 GAAAGACATTCCAGTTGTTTGGG + Intergenic
986799703 5:11246585-11246607 AGAATCAATTTCTGTTGTTTTGG + Intronic
986845463 5:11747157-11747179 GAAATATATTTGTGTTGTCTGGG - Intronic
986904280 5:12474899-12474921 GAGAAAACTTTTTGTTGTTTAGG + Intergenic
986923778 5:12720510-12720532 AAAATGATTTTGTGTTGTTTGGG + Intergenic
987014927 5:13808391-13808413 AAAAGAAACTGCTGTTGTTTAGG + Intronic
987263983 5:16232770-16232792 GAAATAACTTACTGTACTTTAGG + Intergenic
987384601 5:17317116-17317138 GAAATGAATATTTGTGGTTTAGG + Intergenic
987393415 5:17398146-17398168 ACAACACATTTCTGTTGTTTAGG + Intergenic
987445444 5:18012639-18012661 GAAATAATCTTGTGTTTTTTAGG - Intergenic
987585960 5:19856803-19856825 AAAATAAATTTCTGTTGTTTCGG + Intronic
987717324 5:21588970-21588992 GAAAAAAATTTCTGTCTTTCAGG + Intergenic
987766765 5:22242474-22242496 GACATCATTTTCTGTTCTTTTGG - Intronic
987959392 5:24785932-24785954 GACAAAAATTTCTGTTTTCTGGG + Intergenic
987976782 5:25024977-25024999 ACAGTATATTTCTGTTGTTTAGG - Intergenic
988039058 5:25864480-25864502 AAAATAAAATTCTGATATTTAGG - Intergenic
988179014 5:27765782-27765804 GGAATAGATTTCTGTCATTTCGG - Intergenic
988220834 5:28345130-28345152 GAAATAAATTTCTGTTATTTAGG - Intergenic
988273430 5:29048031-29048053 AAAATAGATTTCTGTTGAATAGG - Intergenic
988343329 5:30004495-30004517 GAAAAACATTTTAGTTGTTTTGG - Intergenic
988436544 5:31181800-31181822 GAAATAAATGTCTCTTGTTTTGG + Intergenic
988625279 5:32868598-32868620 GAAATAAATTTCTGTTGTTGTGG - Intergenic
988702265 5:33687013-33687035 GAAATAAATTTCTGCTGTTTAGG + Intronic
989023308 5:37036611-37036633 GAAATACATTTTTGTTATATAGG + Intronic
989207730 5:38828076-38828098 GAAATAAACATTTGTTGTTTAGG + Intergenic
989335470 5:40311355-40311377 GAAATGAATTTCTGATTATTGGG + Intergenic
989482195 5:41944726-41944748 GCTCTAAATTGCTGTTGTTTTGG - Intergenic
989529138 5:42486505-42486527 GAACTAAGTTTCTGTAATTTGGG + Intronic
989613716 5:43318966-43318988 GAAAGAATTTTCTGGTGTCTGGG + Intergenic
989969281 5:50502576-50502598 GAAATGAATTTATGTATTTTAGG - Intergenic
990434222 5:55771757-55771779 GTATTAAATTTCTATTTTTTTGG + Intronic
990850527 5:60198319-60198341 TACATAAATTACTTTTGTTTAGG - Intronic
991021246 5:61982289-61982311 AAAATAAATATCTGCTGTTTAGG + Intergenic
991031468 5:62086488-62086510 TATATTAATTTCTGTAGTTTGGG + Intergenic
991287762 5:64998154-64998176 GAAATAAGTTTCTGTCATGTTGG + Intronic
991437299 5:66609948-66609970 ACAATAAATTTATGTTGCTTAGG - Intronic
992427926 5:76677529-76677551 AAAATAGAATTTTGTTGTTTGGG - Intronic
992734433 5:79704632-79704654 GAAATAATTTTCTGTTACTGAGG + Intronic
992861505 5:80915575-80915597 GAAATAAACCTCTGTTTATTTGG + Intergenic
993233635 5:85273159-85273181 GAAATAAATCTAAGTTGTGTTGG + Intergenic
993697660 5:91081030-91081052 CAAATAAATGTCTGTTGTTTAGG - Intronic
994152083 5:96459205-96459227 GAAATAAATGTCTGCTTTCTAGG + Intergenic
994542227 5:101113917-101113939 GTAATGAATTTCTGTTGTTTAGG - Intergenic
994665952 5:102705483-102705505 AAAATAAATGTCTGTTGTTTAGG - Intergenic
994724503 5:103418285-103418307 GAAATAAATTTCTTTTTTATAGG + Intergenic
995018778 5:107343620-107343642 GAAATAATTTTTTTTTATTTTGG + Intergenic
995034345 5:107515994-107516016 GAAATAAAATTCTAGTGTCTAGG - Intronic
995097681 5:108258329-108258351 AAAATAAATTTCTGTTGTTTAGG + Intronic
995230269 5:109753529-109753551 GAAATAAATTTATGTTGCCATGG - Intronic
995326546 5:110895388-110895410 GACATAAATGTATTTTGTTTTGG + Intergenic
995333463 5:110972128-110972150 GAAATAAAAGTCAGTTATTTGGG + Intergenic
995565243 5:113427331-113427353 GATACAAACTGCTGTTGTTTGGG + Intronic
995750096 5:115444609-115444631 GAATTTAAATTCTGTTGATTTGG - Intergenic
995933512 5:117480934-117480956 GAAATAAATGTTTGTTTTTTAGG + Intergenic
995958852 5:117814692-117814714 TCAATAAATTTTTGTAGTTTTGG - Intergenic
996160338 5:120154267-120154289 GAAATGAATTTATCTTGTTCAGG - Intergenic
996414693 5:123197564-123197586 ATAATAAATTTCTGTCATTTCGG + Intergenic
996516271 5:124372989-124373011 GAAATAAATTTCTCTCATTTAGG - Intergenic
996706396 5:126502656-126502678 GAAATAAATTTGTCTTATTTGGG - Intergenic
996822831 5:127649661-127649683 GAAATAAATTACTGCAGCTTAGG - Intronic
997309050 5:132864615-132864637 TAAATAAATTTCAGGTGTGTGGG + Exonic
997639113 5:135437108-135437130 CAAATAAATGTCTGTCGTGTGGG + Intergenic
997855574 5:137369644-137369666 GAAGTAAATTCCTGTTGTTTAGG - Intronic
998587539 5:143443259-143443281 GAAATAAAATTCTGTTGTATAGG - Intergenic
998657613 5:144199571-144199593 TAAGTATATTTCTGTTGGTTAGG + Intronic
998902447 5:146870546-146870568 AAACAAAATTTCTGTTATTTAGG + Intronic
999346505 5:150826096-150826118 GAAAGAAATATGTGTTTTTTAGG - Intergenic
999511569 5:152257807-152257829 AAAATAAGCTTCTGTTGTATAGG - Intergenic
999561226 5:152805345-152805367 GACATAAATTTGTGTTCTGTGGG + Intergenic
999623785 5:153498880-153498902 GTAATCAAATTATGTTGTTTGGG + Intronic
999878042 5:155830179-155830201 AAAATAAATTTCTATTGTATTGG - Intergenic
1000127181 5:158257323-158257345 GTAATAAATATCTATTGTTGAGG + Intergenic
1000201242 5:159013038-159013060 GAAATAGATTTCTGCTGTTTAGG + Intronic
1000461201 5:161520762-161520784 GAAAAGAAATTCTGTTGTTTTGG + Intronic
1000470422 5:161633324-161633346 GAAATTAATTTCTTTTGCATGGG + Intronic
1000524617 5:162341072-162341094 GAAATAAATGTCTGTTGTTTAGG + Intergenic
1000690510 5:164313334-164313356 GAGATAAATATCTGTAGTGTGGG - Intergenic
1000785044 5:165532676-165532698 AAAATAAATTTCTGTTGTTCAGG + Intergenic
1000954089 5:167521691-167521713 GAAAAATATTGCTGTTGTGTTGG + Intronic
1001649571 5:173305911-173305933 GAAATACATTTCTGTTTTTTTGG + Intergenic
1002353400 5:178602239-178602261 GAAAAAAATGTCTGTTGCTATGG - Intergenic
1002470275 5:179430896-179430918 GGAACACATTTCTGTTGTTCAGG - Intergenic
1002945114 6:1753566-1753588 GAAATTATATTCTGTTGATTTGG - Intronic
1003347465 6:5283825-5283847 GAAACAAATTTTTATTGATTGGG - Intronic
1003380072 6:5616921-5616943 GAGAGAAATTTCTGTTGTGCTGG + Intronic
1003574632 6:7281301-7281323 GAGAAACATTTCTGTTATTTGGG - Exonic
1003801416 6:9672916-9672938 GAAGTTATTTACTGTTGTTTTGG - Intronic
1003902398 6:10667304-10667326 GAATGTAAATTCTGTTGTTTTGG + Intergenic
1003991010 6:11486607-11486629 GAAATAAATTTCTGTTACTTAGG - Intergenic
1004054098 6:12117109-12117131 GGAATAAAGTTCTTTTATTTAGG - Intronic
1004078193 6:12364635-12364657 AAGATAAATTTCTGTTATATAGG - Intergenic
1004086266 6:12452550-12452572 ATAATAAATTTCTGCTGTTTGGG - Intergenic
1004099869 6:12598247-12598269 AACATAAATTGCTGTTGGTTTGG - Intergenic
1004493538 6:16141395-16141417 TAAATAAGTTTATCTTGTTTGGG + Intronic
1004966571 6:20858546-20858568 TATATAAATTTGTGTAGTTTTGG + Intronic
1005190487 6:23216265-23216287 AAAATAAATTTCTGTTGTTTAGG - Intergenic
1005330360 6:24744026-24744048 GAAATAAATTTTTGTTCTAGTGG + Intergenic
1005467568 6:26130350-26130372 GGAATAAATTTATCTTGTATGGG - Intronic
1006891962 6:37436463-37436485 AGAATAAATGTCTGTTGTTTTGG - Intronic
1006915700 6:37592571-37592593 AAAATAAACTTCTGCTGTTTAGG - Intergenic
1007349747 6:41261082-41261104 AAATTAAATTTCAGTAGTTTTGG - Intergenic
1008353503 6:50521962-50521984 GCAATTAATTTTTGTTGTTATGG - Intergenic
1008874733 6:56313399-56313421 AAAATAAATTTCTACTGTTTTGG - Intronic
1009057426 6:58353758-58353780 GAAATAAATCTCTGTTGAAAGGG - Intergenic
1009233388 6:61093316-61093338 GAAATAAATCTCTGTTGAAAGGG + Intergenic
1009412747 6:63385063-63385085 AAAATAAATTTCTGTTCTTTAGG + Intergenic
1009488593 6:64258132-64258154 GAATTTAATTTCTGCTGTGTAGG - Intronic
1009699976 6:67163941-67163963 TAAATAATTTTCTGTAGTTTTGG - Intergenic
1009731005 6:67606802-67606824 ATAATAAAATTCTGTTATTTGGG - Intergenic
1009764914 6:68059689-68059711 GTAATAAATGTATGTTTTTTTGG - Intergenic
1009896894 6:69762902-69762924 GAAATAAATGTTTATTGATTAGG + Intronic
1009918210 6:70023546-70023568 AAAATAAAGTTATGTTGGTTGGG - Intronic
1010057977 6:71587546-71587568 GGCATAAATCTGTGTTGTTTTGG + Intergenic
1010108960 6:72202245-72202267 AAAATAAATTCCTGTTGTTTAGG - Intronic
1010356146 6:74936153-74936175 AAAATAGATTTCTGTTTTCTAGG + Intergenic
1010391537 6:75343638-75343660 GAAATCAATATCTGGTGTGTAGG - Intronic
1010764805 6:79766870-79766892 GATATATATTTCTGTTTTTATGG - Intergenic
1010846725 6:80718779-80718801 TAAATAAAGTTCTGTCATTTAGG - Intergenic
1010965680 6:82205155-82205177 AAAATATATTTCTATTTTTTAGG + Intronic
1011248690 6:85347312-85347334 GAAATAAATTTTTGTGTTTTAGG + Intergenic
1011314290 6:86014543-86014565 AAGATAAATTTCTGTTTTTTAGG + Intergenic
1011607631 6:89119600-89119622 AGAATAAATTTCTGTTGTTTCGG - Intergenic
1011611218 6:89152092-89152114 GAAATGAATTTTTTTTTTTTTGG - Intronic
1011690224 6:89860011-89860033 GAGACAAATTTTGGTTGTTTAGG - Intronic
1011828170 6:91335509-91335531 GAAATGAATTGCTGTTCATTAGG + Intergenic
1011947976 6:92931121-92931143 AAAGTAAATATCTGGTGTTTAGG - Intergenic
1011967268 6:93174397-93174419 AAAATTAATTTTGGTTGTTTAGG + Intergenic
1012017901 6:93875530-93875552 TAAGTAAATTTCTGTTGCTATGG + Intergenic
1012135815 6:95554414-95554436 GAAAAAAAATTCAGATGTTTAGG - Intergenic
1012541986 6:100372056-100372078 GAAATAAATTACTATTTTTAGGG - Intergenic
1012695804 6:102381914-102381936 GATGTAAATTTCTGTTGTTTAGG + Intergenic
1012809900 6:103944059-103944081 ACAATACATTTCTATTGTTTAGG - Intergenic
1012830321 6:104196330-104196352 GAATTTATATTCTGTTGTTTTGG - Intergenic
1012870713 6:104670141-104670163 AAAATAAATTTTTTTTTTTTAGG - Intergenic
1013531948 6:111027705-111027727 GCAATACATTTCTGTTTTCTAGG + Intronic
1013635525 6:112025926-112025948 ACAATACATTTCTGTTGTTTAGG - Intergenic
1013940137 6:115651196-115651218 GAAATAAATTTCTATTGTTTAGG - Intergenic
1014270272 6:119328553-119328575 AAAATAATTTTCTGCTGTTCAGG + Intronic
1014343719 6:120240055-120240077 AAAATAAATATCTGTTGTTCAGG + Intergenic
1014471086 6:121815843-121815865 AAAATAAGTTTTTGCTGTTTAGG - Intergenic
1014613275 6:123569936-123569958 AAAATAGAACTCTGTTGTTTGGG - Intronic
1014774916 6:125497538-125497560 GAAATAAATTTATGTTGTTTAGG + Intergenic
1014891083 6:126847112-126847134 TACATAAATTTCTGTTGTTTAGG + Intergenic
1014905061 6:127015933-127015955 GAAATAAATTTCTGTTGTTTAGG - Intergenic
1014948692 6:127528541-127528563 GAAGTACATATCTATTGTTTGGG - Intronic
1015138442 6:129901392-129901414 AGAATAAGTTTCTGTTGTTTTGG - Intergenic
1015193849 6:130503814-130503836 GAAATATCTTTCTGTTTTTTTGG - Intergenic
1015338243 6:132066485-132066507 GAAATAAATTGCTGTAGTGTGGG + Intergenic
1015615638 6:135071736-135071758 GAAATAAATGCCTGTTGTTTAGG + Intronic
1015634954 6:135265916-135265938 AAAATAAATTTCTGTTGCTTAGG - Intergenic
1016035716 6:139380705-139380727 GAAATACATTTCTGTTATTTAGG - Intergenic
1016310473 6:142728106-142728128 GAAATAAATGTCTGTTATTTAGG + Intergenic
1016653979 6:146496591-146496613 GCAATGTAATTCTGTTGTTTTGG + Intergenic
1016693222 6:146963428-146963450 TAAATATATTGCTATTGTTTTGG - Intergenic
1016838344 6:148501920-148501942 GAAATAGATTGCAGTTGATTAGG + Intronic
1016876325 6:148869153-148869175 GAAAGGAATTTCTGATGTTAAGG + Intronic
1017333239 6:153224108-153224130 AAAATAAACTTCTGTTGTTTAGG + Intergenic
1017439744 6:154452919-154452941 GAGATAAATTTCTGTTGTTCCGG + Intronic
1017645167 6:156533510-156533532 AAAATAAATATTTATTGTTTAGG - Intergenic
1018151969 6:160948058-160948080 CAAATAAAATTCTTTTGCTTTGG - Intergenic
1018446432 6:163863107-163863129 ACAGTAAATTTCTGTTGTTCCGG + Intergenic
1018758126 6:166867079-166867101 GCAATCATATTCTGTTGTTTTGG + Intronic
1019065275 6:169291136-169291158 GGAACACATTTTTGTTGTTTAGG - Intergenic
1019736941 7:2655132-2655154 GAAATCCATTTCTTTTTTTTTGG + Intronic
1019833348 7:3356167-3356189 AATATAAATATCTGTAGTTTTGG + Intronic
1020313988 7:6891456-6891478 AAAATCAATGTCTGTTATTTAGG + Intergenic
1020468967 7:8513849-8513871 ACAATACGTTTCTGTTGTTTAGG - Intronic
1020842949 7:13243700-13243722 GAAGTAAATTTCTGTTGTTGAGG + Intergenic
1021208819 7:17818207-17818229 AAAATACATTTCTGTTGTTTGGG + Intronic
1021221916 7:17984592-17984614 GCATTATATTTGTGTTGTTTTGG - Intergenic
1021342673 7:19484057-19484079 GAAATAATTTCCTGTGTTTTGGG - Intergenic
1021463501 7:20915001-20915023 GCAATAACATTCTGTTTTTTAGG + Intergenic
1021520418 7:21534531-21534553 GAATGTAAATTCTGTTGTTTTGG + Intergenic
1021531569 7:21652286-21652308 GAAGTCAGTTTTTGTTGTTTGGG - Intronic
1021677305 7:23094329-23094351 GAAATAAATTCTTGTAGTTATGG - Intergenic
1021689981 7:23222273-23222295 GAAGTAAATTTCTGTGATTCAGG + Intergenic
1021916277 7:25436166-25436188 TAAATCAATTTCAGTTTTTTAGG - Intergenic
1021928343 7:25554470-25554492 GAAATACATATCTGTGGTGTTGG - Intergenic
1022474727 7:30702297-30702319 GAAATCAATGTCTGTTGTTAAGG - Intronic
1022719125 7:32926861-32926883 AAAATCAATTTCTGTTGTTTAGG - Intergenic
1022738516 7:33099008-33099030 AAAACCAGTTTCTGTTGTTTAGG - Intronic
1022754559 7:33271887-33271909 GAATGAATATTCTGTTGTTTTGG - Intronic
1023106614 7:36769251-36769273 AAAACAAATGTCTGTTGTTTAGG - Intergenic
1023182432 7:37498626-37498648 GAAGTAAATTTCTTCTCTTTTGG - Intergenic
1023579240 7:41663666-41663688 GAAATTCTTTTTTGTTGTTTTGG - Intergenic
1023803127 7:43852103-43852125 ATAATAAATGTGTGTTGTTTAGG - Intergenic
1023928304 7:44687396-44687418 AAAAAAAATTTCTTTTTTTTTGG - Intronic
1024378852 7:48671056-48671078 GAAATAAATTTCTGATGTGTGGG - Intergenic
1024562936 7:50659902-50659924 GAAATGCATTTCTGTCGTCTGGG + Intronic
1024819355 7:53309191-53309213 GAAAAAAAATACTATTGTTTAGG + Intergenic
1025596396 7:62932556-62932578 GATAAAAATTTCTGTTGATATGG - Intergenic
1025624105 7:63202991-63203013 TAAGTAAATTTCTTTTATTTTGG + Intergenic
1027594992 7:80162254-80162276 GAAATAAGTGCTTGTTGTTTAGG + Intronic
1027766064 7:82343856-82343878 GAAATATATTTAGGTCGTTTGGG - Intronic
1027834339 7:83220561-83220583 CAAATAAATGTCTGCTCTTTTGG + Intergenic
1027901152 7:84116826-84116848 AACATAAATTTCTGCTGTTTTGG + Intronic
1028003429 7:85530963-85530985 GAAATGAATTTCTGTTGTCATGG + Intergenic
1028340484 7:89713246-89713268 AAAATAAATTTATGTTGTTTAGG + Intergenic
1028361075 7:89966787-89966809 AAAATAAATTTCTGTTGTTTCGG - Intergenic
1028567962 7:92253816-92253838 GTCATAAATTTCTCCTGTTTTGG + Intronic
1028791797 7:94861880-94861902 GAAATAAATTTCTATTGTTTAGG - Intergenic
1028890126 7:95977769-95977791 GAAATAAATGACTCTTGCTTTGG - Intronic
1029809926 7:103037109-103037131 GAACTAGATTCATGTTGTTTAGG - Intronic
1029878807 7:103783518-103783540 GAAAAAAAATTCTGTGGCTTAGG - Intronic
1029907570 7:104106945-104106967 ACAATAAATCTCTGTTGTTTAGG - Intergenic
1030037323 7:105419108-105419130 GAATTACATTTCTTTTGATTGGG - Intergenic
1030175699 7:106650911-106650933 GAAATAAACGTCTGTTGTTTAGG - Intergenic
1030351408 7:108492060-108492082 GAAATAAAATTCTCTTATTATGG - Intronic
1030436704 7:109530799-109530821 AAAATAAATTTGTGTTTTTATGG + Intergenic
1030518769 7:110570301-110570323 GAAAAAAATGTAGGTTGTTTGGG - Intergenic
1030829784 7:114207158-114207180 CAAATAATATTCTGTTGTTTGGG + Intronic
1031182898 7:118439355-118439377 GAATTTATATTCTGTTGTTTAGG - Intergenic
1031642179 7:124178730-124178752 GAAATAAATGTTTCTTGTTTAGG + Intergenic
1031957275 7:127955335-127955357 GACATTTATTTCTGTTGGTTAGG + Intronic
1032534163 7:132646669-132646691 GAAATCAATGCCTGTTGTTTAGG + Intronic
1033003090 7:137529169-137529191 GTAATAAATTTCTGTGCTTAGGG + Intronic
1033106415 7:138530118-138530140 AAAATAATTCTCTGTTCTTTTGG + Intronic
1033372420 7:140722052-140722074 GACAGAAATTGCTGTAGTTTAGG - Exonic
1033663423 7:143419388-143419410 GAAATAAATTTCTGACCTCTGGG + Intergenic
1034679484 7:152917727-152917749 AGAATAATATTCTGTTGTTTGGG + Intergenic
1035455971 7:159008956-159008978 GAAATATATTTCTGGTCTTTTGG - Intergenic
1035481635 7:159191732-159191754 GAAATAAATGTTTGTTGTTGAGG + Intergenic
1035823623 8:2621096-2621118 GCAATAGATTCTTGTTGTTTTGG + Intergenic
1035865086 8:3073962-3073984 GGAATAAATGTGTGCTGTTTTGG - Intronic
1035970600 8:4243617-4243639 GTAATAATTTTCTGTGTTTTCGG - Intronic
1036439425 8:8767163-8767185 AAAATACATTTCTGTTGCTTAGG + Intergenic
1036489838 8:9214701-9214723 ACAATACATTTCTGTTGTGTAGG + Intergenic
1037152271 8:15651703-15651725 AAAATAAATTTCTGTTGGTTAGG + Intronic
1037152862 8:15658595-15658617 GAATTAAATTTCTGTTGCCCAGG - Intronic
1037207953 8:16347550-16347572 GAAATATATTTCTTTTTCTTAGG + Intronic
1038405768 8:27321442-27321464 GAAAGAAATTTAAGTTGCTTGGG - Intronic
1038599949 8:28930045-28930067 GAAACATATTTCTCTTGGTTAGG + Intronic
1038631485 8:29248849-29248871 AAAATAAATTAGTGTTGTCTAGG + Intronic
1038826956 8:31013848-31013870 TAAATAAACTTCTGTGATTTTGG + Intronic
1038915350 8:32015072-32015094 ATGATAAATTTCTGTTGTTTAGG + Intronic
1039068403 8:33629324-33629346 GTAATTAATTTCTGATGTGTGGG + Intergenic
1039088505 8:33803406-33803428 GAAAAAACTTCCTGTTTTTTAGG + Intergenic
1039111548 8:34045652-34045674 GAAAGAAATTTCTGTTTCCTTGG + Intergenic
1039156616 8:34566054-34566076 GATATAAATATTTATTGTTTGGG + Intergenic
1039817490 8:41107322-41107344 GATATATATTTGTGTTGTTCTGG + Intergenic
1039860041 8:41449183-41449205 TAAATCAATGTCTGCTGTTTGGG - Intergenic
1040548332 8:48419529-48419551 GAGAGAAATTTGTTTTGTTTGGG - Intergenic
1040644314 8:49380454-49380476 AAAATAAATTTGTGTTTTTAAGG + Intergenic
1040800063 8:51330520-51330542 AAAGTAAATTTCTGTTGTTTAGG - Intronic
1040856040 8:51948864-51948886 AAAATACATTTTTCTTGTTTAGG + Intergenic
1040949673 8:52924942-52924964 GAAGAAACTTTCTGTTGTTTAGG + Intergenic
1041008123 8:53515549-53515571 AAAGTACATTTCTGTTGCTTAGG - Intergenic
1041087197 8:54267898-54267920 GACACAAATTTCTGTTATTTTGG + Intergenic
1041446594 8:57958517-57958539 GAAATAAACTGCTTATGTTTTGG - Intergenic
1041627294 8:60045057-60045079 AAAATACATTTCTGTTTCTTAGG + Intergenic
1041962733 8:63637251-63637273 ATAACAAATTTCTGTTTTTTAGG + Intergenic
1041988713 8:63958426-63958448 GAATTAAATTTCTTCTGTATAGG + Intergenic
1042287630 8:67131395-67131417 GCAATAAAGTGCTGTTTTTTTGG - Intronic
1042376124 8:68055127-68055149 GAAAGAAAGTTGTGTTGCTTTGG - Intronic
1042728745 8:71907867-71907889 AAACTAAAATTTTGTTGTTTGGG - Intronic
1042736188 8:71992177-71992199 GATATAATTTTCTTCTGTTTAGG + Intronic
1043052095 8:75396912-75396934 AATGTAAATTTCTGTTATTTAGG - Intergenic
1043211698 8:77527428-77527450 GACTTCAATTTCTGTTCTTTCGG + Intergenic
1043251820 8:78084247-78084269 GAAATAATTTACTTTTATTTCGG - Intergenic
1043558222 8:81459237-81459259 GAAAGAACTTTCTGTTCTTATGG + Exonic
1043663094 8:82771377-82771399 GAAATTTATTTCTGTTTTTCTGG + Intergenic
1043812458 8:84758402-84758424 ATAATAAATGTTTGTTGTTTTGG - Intronic
1044059342 8:87615195-87615217 AAAAAAAAAATCTGTTGTTTAGG + Intronic
1044589496 8:93899896-93899918 CTAATAAATACCTGTTGTTTTGG + Intronic
1044750055 8:95407258-95407280 GAAATAAACCTATGTTGGTTGGG - Intergenic
1044975529 8:97661580-97661602 GAAATAGATTTCTGTTGTGTTGG + Intronic
1045224919 8:100235064-100235086 AGAATAGATTTCTGTTGTTCAGG - Intronic
1045720957 8:105110062-105110084 GAAATAAATATGTATTGTGTTGG + Intronic
1045871407 8:106931750-106931772 CAAAAAAATTTCTGTTCTCTTGG + Intergenic
1046097996 8:109582987-109583009 TAAATACATTTCTGTTGTTTAGG + Intronic
1046264841 8:111817225-111817247 AGAATATTTTTCTGTTGTTTAGG + Intergenic
1046886210 8:119369972-119369994 GAAATAAATTTCTGTTGTTTAGG + Intergenic
1047046768 8:121062527-121062549 GAAATAAAATTCTGTGGCCTTGG - Intergenic
1047351515 8:124078891-124078913 AGAATGAATTTCTGTTGTTTCGG - Intronic
1047404884 8:124577246-124577268 GCAGTAAATTTCTTTTATTTTGG + Intronic
1047583710 8:126245184-126245206 GAAAAAAATGTCTCTAGTTTTGG - Intergenic
1047653147 8:126946433-126946455 AAAATACATTTTTTTTGTTTTGG - Intergenic
1047767642 8:128002451-128002473 AGAATACATTTCTGTTGTTTTGG - Intergenic
1048313871 8:133347883-133347905 TAAACAAATTTCTGTTGTTTAGG + Intergenic
1048476999 8:134752622-134752644 GAAATAAATGTCTTTTGTTCAGG - Intergenic
1048543701 8:135366667-135366689 AAAATAAATTTCGGTTGTTTAGG - Intergenic
1048678831 8:136815578-136815600 GAAATAACTTTCTGTAGATTTGG - Intergenic
1048775131 8:137937292-137937314 GAAATATAGTTCTGTAGCTTAGG + Intergenic
1048921740 8:139237607-139237629 ACAATACATTTCTGTTGTTAAGG + Intergenic
1049452835 8:142671464-142671486 GATATAAATTTGTATTGTTTTGG + Intronic
1050014637 9:1220758-1220780 TAAACAAATTTATGTTGTTATGG - Intergenic
1050072217 9:1827277-1827299 AAAATCAATTTCTGTTTTTTAGG + Intergenic
1050095444 9:2060373-2060395 CAAGTGAATTTTTGTTGTTTGGG + Intronic
1050209814 9:3240718-3240740 TAAATAAATAACTCTTGTTTGGG - Intronic
1050461746 9:5883256-5883278 TAAATAAACATCTTTTGTTTTGG + Intronic
1050623470 9:7478623-7478645 GGAAAAGATTTCTGTTCTTTTGG + Intergenic
1050799279 9:9589169-9589191 CAAATAAACTACTGTTGTATTGG - Intronic
1050867785 9:10525497-10525519 TAAATCAATTACAGTTGTTTAGG - Intronic
1050907216 9:11019453-11019475 GAAAGAATTTTCTGTACTTTTGG - Intergenic
1050916267 9:11137829-11137851 GAAATTAATTTCTGTTGTTTAGG + Intergenic
1051062127 9:13056812-13056834 GAAATATATTTCTGTTGTCTAGG - Intergenic
1051323839 9:15942467-15942489 GAGAGAAATTGCTGTTGTGTGGG + Intronic
1051690952 9:19711773-19711795 GAACAAAATCTCTGTTGTGTAGG + Intronic
1051817769 9:21130131-21130153 GAAATAAATGTCTGTTATTTAGG - Intergenic
1051952704 9:22656108-22656130 GAAATACATGGCTGTTGTGTAGG + Intergenic
1052036493 9:23687178-23687200 GAAAAAAAGTTTTGCTGTTTAGG + Intergenic
1052050270 9:23839167-23839189 AAAATAAGTTTCTGTTATTTTGG - Intergenic
1052114876 9:24638316-24638338 GAAAGTATATTCTGTTGTTTTGG + Intergenic
1052531224 9:29686456-29686478 GAAATAAATTACTCTAATTTTGG - Intergenic
1052569603 9:30202352-30202374 ATAATAAATTTGTGTTGTTCAGG + Intergenic
1052579368 9:30334324-30334346 AAAATAAAATTCTGTTATTTAGG + Intergenic
1052596654 9:30569536-30569558 GAAATAAATTTCTCTTCTACTGG + Intergenic
1052680215 9:31681693-31681715 GAAGTAATTTTCTGTAATTTTGG - Intergenic
1053163127 9:35827491-35827513 CAAATAAATTGATGTTGTTCTGG + Intronic
1053550045 9:39067983-39068005 AAAACTAATTTCTGTCGTTTTGG - Intergenic
1053611941 9:39722781-39722803 AAAATAAATTTCTGTGGTTTAGG + Intergenic
1053869979 9:42480776-42480798 AAAATAAATTTCTGTGGTTGAGG + Intergenic
1054086313 9:60748374-60748396 AAAATAAATTTCTGTGGTTTAGG - Intergenic
1054241578 9:62619612-62619634 AAAATAAATTTCTGTGGTTTAGG - Intergenic
1054555704 9:66654135-66654157 AAAATAAATTTCTGTGGTTTAGG - Intergenic
1054943143 9:70765661-70765683 GAACTAGATTTCTTCTGTTTGGG + Intronic
1055141367 9:72880921-72880943 CAAATAAGTCTTTGTTGTTTGGG + Intergenic
1055596281 9:77868174-77868196 TAAGTATATGTCTGTTGTTTAGG - Intronic
1056265202 9:84889980-84890002 GATATAAATGTCTGCTGTTTGGG + Intronic
1057151636 9:92801095-92801117 AGAATAAATTCCTGATGTTTAGG - Intergenic
1057477445 9:95414836-95414858 GAAATAAATGTTCATTGTTTAGG - Intergenic
1058012840 9:99997599-99997621 GAACAAAATTTCTGTTATTTGGG + Intronic
1058112445 9:101046012-101046034 AATATAAATTTCTGTAATTTTGG - Intronic
1058417909 9:104807042-104807064 GAAATGCATTTCTATTTTTTAGG + Intronic
1058680169 9:107433915-107433937 ACAATAAATTTCTGTTGTTTAGG - Intergenic
1059025431 9:110622890-110622912 TAAATATATTTTTCTTGTTTTGG + Intergenic
1059131834 9:111760077-111760099 GATATAAATTAATGCTGTTTGGG - Intronic
1059497010 9:114718349-114718371 AAAATAAATGTCTGTTGTTTAGG + Intergenic
1059621792 9:116013780-116013802 TAAATTATTTTCTGGTGTTTTGG + Intergenic
1059753995 9:117275380-117275402 AAAATAAAATTCTGTTGTTGAGG - Intronic
1059853294 9:118367462-118367484 GAAATAAAAGTTTGTTGTTAAGG - Intergenic
1060617319 9:125029453-125029475 GAAATAAATTTGTTTTCATTTGG + Intronic
1061106655 9:128535971-128535993 GAGATAAATTGCTTTTTTTTGGG - Intronic
1061277102 9:129575524-129575546 CAAATAAGTGTCTGTTGTTTAGG + Intergenic
1062274110 9:135722608-135722630 GAAATAAATCTCTGTTGCTGAGG - Intronic
1203488699 Un_GL000224v1:83288-83310 GAAAGAAAATACTCTTGTTTGGG - Intergenic
1203501320 Un_KI270741v1:25183-25205 GAAAGAAAATACTCTTGTTTGGG - Intergenic
1186009809 X:5116721-5116743 GGAATAAATGTCTTTTGTTTAGG + Intergenic
1186102638 X:6173245-6173267 TAAAAAAATTTGTGTTGTTGGGG + Intronic
1186129233 X:6448472-6448494 AGAATAAATATCTGTTGTTTAGG - Intergenic
1186716705 X:12259558-12259580 ACAATAAATTTCTGTTGTTTTGG + Intronic
1187221226 X:17328035-17328057 GAAATAAATGTTTGTTGTTTAGG - Intergenic
1187402534 X:18974555-18974577 GAAATATATTTCTGTTGTTTAGG - Intronic
1187694409 X:21904292-21904314 GAAATACATCTTTGTTGTTTGGG - Intergenic
1187973967 X:24686859-24686881 GGAATCAATTTTTGTTGTTTTGG - Intergenic
1187977805 X:24720961-24720983 GAAATAAATTTCTGTGATGATGG - Intronic
1188032871 X:25283956-25283978 ACAATAAATTTCTATTGTTTAGG - Intergenic
1188114390 X:26225366-26225388 GGAATCAGTTTATGTTGTTTAGG - Intergenic
1188343442 X:29033989-29034011 GGAATAAATTTATGTTATTATGG - Intronic
1188363859 X:29290473-29290495 GAAATAAATATGTATTGTTCAGG - Intronic
1188897685 X:35688911-35688933 GAACTTAAATTCTTTTGTTTTGG + Intergenic
1188954695 X:36420093-36420115 ACAATAAATTTCTGTTGTTTAGG + Intergenic
1189532249 X:41897699-41897721 GAAGTAAATTTATTTTGTTAAGG + Intronic
1189975642 X:46459334-46459356 AAAAGAAATTTCTGATGTCTAGG + Intronic
1190024232 X:46908138-46908160 GAGATAAAAGTCTGTAGTTTGGG - Intergenic
1190364538 X:49679142-49679164 GAAGTTAATTTCTGTTGCTTTGG + Intergenic
1190447958 X:50549445-50549467 GAAATAAGTTTTTGTTTCTTTGG - Intergenic
1191661761 X:63658868-63658890 CAAATATATATCTGTTATTTTGG - Intronic
1191681867 X:63848794-63848816 ACAATAAATTTCTGTTGTAAAGG - Intergenic
1191937475 X:66440785-66440807 AAAATAAATTTCTTTTACTTGGG + Intergenic
1192349122 X:70341311-70341333 GAAATATATTTATGTTGATTAGG + Intronic
1193590186 X:83379943-83379965 AAAATAAATTTATGTTTTTTAGG + Intergenic
1193610643 X:83628008-83628030 GAAAGTATATTCTGTTGTTTTGG + Intergenic
1193800312 X:85927637-85927659 GATTTAAATGTCTGTTGTTTGGG - Intronic
1193982949 X:88207437-88207459 GAACTAAATTCCTTTTGTTCAGG + Intergenic
1194378698 X:93166901-93166923 GAAATATACTCCTTTTGTTTGGG + Intergenic
1194678903 X:96827820-96827842 CAAATAACTTTTTTTTGTTTTGG + Intronic
1194764287 X:97831154-97831176 GAAACAAATTTCTTTTTCTTTGG - Intergenic
1194877437 X:99207529-99207551 GAAATAAACTTCATTTGTTTGGG - Intergenic
1194938796 X:99984476-99984498 AAAATAAGTTCCTGTTGTTTAGG - Intergenic
1195276904 X:103290033-103290055 AAAATAAATTTCTGTTGTTTAGG + Intergenic
1195396922 X:104421171-104421193 GCAATAAAATCCTGCTGTTTCGG - Intergenic
1195770754 X:108348510-108348532 AAAATAAATATGTGTTCTTTGGG + Intronic
1196199153 X:112865936-112865958 GCAATATAATTCTGTTGCTTTGG + Intergenic
1196228673 X:113195443-113195465 AAGATAAATTTATATTGTTTAGG + Intergenic
1196374859 X:115022069-115022091 GAAAGAAATTACTGTTATTATGG - Intergenic
1196896227 X:120339599-120339621 AAAATACACTTCTGTTGTTTAGG - Intergenic
1196939089 X:120758182-120758204 GAAATAAATTTCTGTTCATAAGG + Intergenic
1197300851 X:124778535-124778557 GAAATAAAATAATGTTGCTTTGG + Intronic
1197370348 X:125619143-125619165 GAATGAATGTTCTGTTGTTTTGG + Intergenic
1197589799 X:128394316-128394338 AAAATAAATTTTTGCTGTTTAGG + Intergenic
1197993331 X:132342944-132342966 GAAAGAGTTTTCTGTTGTGTTGG + Intergenic
1198062020 X:133055661-133055683 AACATACGTTTCTGTTGTTTAGG - Intronic
1198170912 X:134104358-134104380 AAATTAAATTTCTGTTGCTTGGG + Intergenic
1198433989 X:136597364-136597386 ACAATACATTTCTGTTGTTTAGG - Intergenic
1199019068 X:142853945-142853967 AAAATACATTTCTGTTGCTTAGG + Intergenic
1199038796 X:143085464-143085486 GAAATAAAGTTTTGTTGTTTAGG + Intergenic
1199056030 X:143296056-143296078 GAAATAATTTTATGTTGCCTTGG + Intergenic
1199292159 X:146116954-146116976 AAAATATATTTCTCTTGTTTTGG + Intergenic
1199303382 X:146238838-146238860 AAAATAAATGTCTGTTGTCTAGG - Intergenic
1199378269 X:147137837-147137859 GCAATACATTTCTGTTGTTTAGG + Intergenic
1199663906 X:150081561-150081583 AAAATCCATTTCTGTTGTTCAGG - Intergenic
1200465624 Y:3513641-3513663 GAAATAATTTTGTTTTTTTTTGG + Intergenic
1201424499 Y:13833405-13833427 AAAATAAATGTCTGTTGTTTAGG + Intergenic
1202033242 Y:20601346-20601368 AAAATAAAGTTCTGCTATTTGGG + Intergenic
1202605207 Y:26633668-26633690 GAAAGAAATTTTTTTTGGTTGGG + Intergenic