ID: 927327347

View in Genome Browser
Species Human (GRCh38)
Location 2:21820389-21820411
Sequence GTTCAGATTCCAGAACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927327347_927327350 1 Left 927327347 2:21820389-21820411 CCTCACAGTTCTGGAATCTGAAC No data
Right 927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG No data
927327347_927327354 27 Left 927327347 2:21820389-21820411 CCTCACAGTTCTGGAATCTGAAC No data
Right 927327354 2:21820439-21820461 TTTTCTGGTTGGTCTCTTCCTGG No data
927327347_927327351 12 Left 927327347 2:21820389-21820411 CCTCACAGTTCTGGAATCTGAAC No data
Right 927327351 2:21820424-21820446 GTGCCGGTCTGGTTGTTTTCTGG No data
927327347_927327353 16 Left 927327347 2:21820389-21820411 CCTCACAGTTCTGGAATCTGAAC No data
Right 927327353 2:21820428-21820450 CGGTCTGGTTGTTTTCTGGTTGG No data
927327347_927327349 -4 Left 927327347 2:21820389-21820411 CCTCACAGTTCTGGAATCTGAAC No data
Right 927327349 2:21820408-21820430 GAACTCTGAAATCAAGGTGCCGG No data
927327347_927327348 -10 Left 927327347 2:21820389-21820411 CCTCACAGTTCTGGAATCTGAAC No data
Right 927327348 2:21820402-21820424 GAATCTGAACTCTGAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927327347 Original CRISPR GTTCAGATTCCAGAACTGTG AGG (reversed) Intergenic
No off target data available for this crispr