ID: 927327350

View in Genome Browser
Species Human (GRCh38)
Location 2:21820413-21820435
Sequence CTGAAATCAAGGTGCCGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927327347_927327350 1 Left 927327347 2:21820389-21820411 CCTCACAGTTCTGGAATCTGAAC No data
Right 927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG No data
927327345_927327350 23 Left 927327345 2:21820367-21820389 CCTAAACAACAGAAATTTATTTC 0: 9
1: 53
2: 135
3: 204
4: 781
Right 927327350 2:21820413-21820435 CTGAAATCAAGGTGCCGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927327350 Original CRISPR CTGAAATCAAGGTGCCGGTC TGG Intergenic
No off target data available for this crispr