ID: 927333458

View in Genome Browser
Species Human (GRCh38)
Location 2:21892844-21892866
Sequence TGAGTACTAGGCTTAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927333458_927333463 26 Left 927333458 2:21892844-21892866 CCAGCTGCTAAGCCTAGTACTCA No data
Right 927333463 2:21892893-21892915 TCCTCTCACTTTCTACCCTGAGG No data
927333458_927333465 30 Left 927333458 2:21892844-21892866 CCAGCTGCTAAGCCTAGTACTCA No data
Right 927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927333458 Original CRISPR TGAGTACTAGGCTTAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr