ID: 927333459 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:21892856-21892878 |
Sequence | AAAAATAACTAATGAGTACT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
927333459_927333463 | 14 | Left | 927333459 | 2:21892856-21892878 | CCTAGTACTCATTAGTTATTTTT | No data | ||
Right | 927333463 | 2:21892893-21892915 | TCCTCTCACTTTCTACCCTGAGG | 0: 1 1: 1 2: 1 3: 45 4: 398 |
||||
927333459_927333465 | 18 | Left | 927333459 | 2:21892856-21892878 | CCTAGTACTCATTAGTTATTTTT | No data | ||
Right | 927333465 | 2:21892897-21892919 | CTCACTTTCTACCCTGAGGCAGG | 0: 1 1: 0 2: 1 3: 34 4: 294 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
927333459 | Original CRISPR | AAAAATAACTAATGAGTACT AGG (reversed) | Intergenic | ||