ID: 927333459

View in Genome Browser
Species Human (GRCh38)
Location 2:21892856-21892878
Sequence AAAAATAACTAATGAGTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7429
Summary {0: 104, 1: 1031, 2: 1776, 3: 2018, 4: 2500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927333459_927333463 14 Left 927333459 2:21892856-21892878 CCTAGTACTCATTAGTTATTTTT 0: 104
1: 1031
2: 1776
3: 2018
4: 2500
Right 927333463 2:21892893-21892915 TCCTCTCACTTTCTACCCTGAGG No data
927333459_927333465 18 Left 927333459 2:21892856-21892878 CCTAGTACTCATTAGTTATTTTT 0: 104
1: 1031
2: 1776
3: 2018
4: 2500
Right 927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927333459 Original CRISPR AAAAATAACTAATGAGTACT AGG (reversed) Intergenic
Too many off-targets to display for this crispr