ID: 927333460 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:21892879-21892901 |
Sequence | GTGAGAGGAGGGAGTAGATC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
927333460_927333463 | -9 | Left | 927333460 | 2:21892879-21892901 | CCTGATCTACTCCCTCCTCTCAC | No data | ||
Right | 927333463 | 2:21892893-21892915 | TCCTCTCACTTTCTACCCTGAGG | No data | ||||
927333460_927333465 | -5 | Left | 927333460 | 2:21892879-21892901 | CCTGATCTACTCCCTCCTCTCAC | No data | ||
Right | 927333465 | 2:21892897-21892919 | CTCACTTTCTACCCTGAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
927333460 | Original CRISPR | GTGAGAGGAGGGAGTAGATC AGG (reversed) | Intergenic | ||