ID: 927333463

View in Genome Browser
Species Human (GRCh38)
Location 2:21892893-21892915
Sequence TCCTCTCACTTTCTACCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927333458_927333463 26 Left 927333458 2:21892844-21892866 CCAGCTGCTAAGCCTAGTACTCA No data
Right 927333463 2:21892893-21892915 TCCTCTCACTTTCTACCCTGAGG No data
927333457_927333463 27 Left 927333457 2:21892843-21892865 CCCAGCTGCTAAGCCTAGTACTC No data
Right 927333463 2:21892893-21892915 TCCTCTCACTTTCTACCCTGAGG No data
927333460_927333463 -9 Left 927333460 2:21892879-21892901 CCTGATCTACTCCCTCCTCTCAC No data
Right 927333463 2:21892893-21892915 TCCTCTCACTTTCTACCCTGAGG No data
927333459_927333463 14 Left 927333459 2:21892856-21892878 CCTAGTACTCATTAGTTATTTTT 0: 104
1: 1031
2: 1776
3: 2018
4: 2500
Right 927333463 2:21892893-21892915 TCCTCTCACTTTCTACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927333463 Original CRISPR TCCTCTCACTTTCTACCCTG AGG Intergenic
No off target data available for this crispr