ID: 927333465

View in Genome Browser
Species Human (GRCh38)
Location 2:21892897-21892919
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927333460_927333465 -5 Left 927333460 2:21892879-21892901 CCTGATCTACTCCCTCCTCTCAC No data
Right 927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG No data
927333458_927333465 30 Left 927333458 2:21892844-21892866 CCAGCTGCTAAGCCTAGTACTCA No data
Right 927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG No data
927333459_927333465 18 Left 927333459 2:21892856-21892878 CCTAGTACTCATTAGTTATTTTT No data
Right 927333465 2:21892897-21892919 CTCACTTTCTACCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type