ID: 927335722

View in Genome Browser
Species Human (GRCh38)
Location 2:21921867-21921889
Sequence TGGTACTATTTCCATTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927335722_927335727 30 Left 927335722 2:21921867-21921889 CCCAAACAATGGAAATAGTACCA No data
Right 927335727 2:21921920-21921942 TGTACTGTAAATCCTGGGTTTGG No data
927335722_927335725 24 Left 927335722 2:21921867-21921889 CCCAAACAATGGAAATAGTACCA No data
Right 927335725 2:21921914-21921936 ATTCTCTGTACTGTAAATCCTGG No data
927335722_927335726 25 Left 927335722 2:21921867-21921889 CCCAAACAATGGAAATAGTACCA No data
Right 927335726 2:21921915-21921937 TTCTCTGTACTGTAAATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927335722 Original CRISPR TGGTACTATTTCCATTGTTT GGG (reversed) Intergenic
No off target data available for this crispr