ID: 927335723

View in Genome Browser
Species Human (GRCh38)
Location 2:21921868-21921890
Sequence TTGGTACTATTTCCATTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927335723_927335727 29 Left 927335723 2:21921868-21921890 CCAAACAATGGAAATAGTACCAA No data
Right 927335727 2:21921920-21921942 TGTACTGTAAATCCTGGGTTTGG No data
927335723_927335725 23 Left 927335723 2:21921868-21921890 CCAAACAATGGAAATAGTACCAA No data
Right 927335725 2:21921914-21921936 ATTCTCTGTACTGTAAATCCTGG No data
927335723_927335726 24 Left 927335723 2:21921868-21921890 CCAAACAATGGAAATAGTACCAA No data
Right 927335726 2:21921915-21921937 TTCTCTGTACTGTAAATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927335723 Original CRISPR TTGGTACTATTTCCATTGTT TGG (reversed) Intergenic
No off target data available for this crispr