ID: 927335724

View in Genome Browser
Species Human (GRCh38)
Location 2:21921887-21921909
Sequence GTTTTCATAAGAGAACTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927335724_927335727 10 Left 927335724 2:21921887-21921909 CCAATGAGTTCTCTTATGAAAAC No data
Right 927335727 2:21921920-21921942 TGTACTGTAAATCCTGGGTTTGG No data
927335724_927335726 5 Left 927335724 2:21921887-21921909 CCAATGAGTTCTCTTATGAAAAC No data
Right 927335726 2:21921915-21921937 TTCTCTGTACTGTAAATCCTGGG No data
927335724_927335725 4 Left 927335724 2:21921887-21921909 CCAATGAGTTCTCTTATGAAAAC No data
Right 927335725 2:21921914-21921936 ATTCTCTGTACTGTAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927335724 Original CRISPR GTTTTCATAAGAGAACTCAT TGG (reversed) Intergenic