ID: 927335727

View in Genome Browser
Species Human (GRCh38)
Location 2:21921920-21921942
Sequence TGTACTGTAAATCCTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927335724_927335727 10 Left 927335724 2:21921887-21921909 CCAATGAGTTCTCTTATGAAAAC No data
Right 927335727 2:21921920-21921942 TGTACTGTAAATCCTGGGTTTGG No data
927335722_927335727 30 Left 927335722 2:21921867-21921889 CCCAAACAATGGAAATAGTACCA No data
Right 927335727 2:21921920-21921942 TGTACTGTAAATCCTGGGTTTGG No data
927335723_927335727 29 Left 927335723 2:21921868-21921890 CCAAACAATGGAAATAGTACCAA No data
Right 927335727 2:21921920-21921942 TGTACTGTAAATCCTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927335727 Original CRISPR TGTACTGTAAATCCTGGGTT TGG Intergenic