ID: 927336763

View in Genome Browser
Species Human (GRCh38)
Location 2:21933525-21933547
Sequence CAGGGTCACCACAGGTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927336763 Original CRISPR CAGGGTCACCACAGGTAAGT AGG Intergenic
900132192 1:1091886-1091908 CAGGGCCACGACAGGGAAGGTGG + Intronic
900210797 1:1454887-1454909 CAGTGTCTCCACAGGTCACTCGG + Intronic
900392151 1:2438392-2438414 CAGGGTCAGCCCAGGTCAGCAGG + Intronic
902645698 1:17796476-17796498 CAGTTTCACCTCTGGTAAGTGGG - Intronic
904187010 1:28713361-28713383 CTAGGTGACCACTGGTAAGTTGG - Intronic
905385529 1:37600988-37601010 CATGGTCACCACTTCTAAGTGGG + Intergenic
907312101 1:53544607-53544629 GAGGGTCCCCAGAGGTCAGTCGG - Intronic
908814440 1:68017281-68017303 CATGGTCACCACAGGAAATTTGG - Intergenic
909951775 1:81728457-81728479 CAGGGTCATCACAGTTATCTAGG - Intronic
911361492 1:96882663-96882685 CAGGCTCACCACTAGTAAGATGG - Intergenic
915629906 1:157145002-157145024 CAGAGTTACCACAAGTAACTGGG - Intergenic
1062979205 10:1707877-1707899 CAGAGTCAGCACTGGTCAGTGGG + Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064301846 10:14129942-14129964 GAGGGCCACCACAGGGAAGAGGG - Intronic
1064395711 10:14980616-14980638 CTGGGACACCCCAGGTCAGTCGG - Intronic
1070748584 10:78950320-78950342 TAGGGTCAACACAAGTAAATGGG + Intergenic
1072270766 10:93774143-93774165 CTTGGTCACCACAGGTAAAGGGG + Intronic
1072624025 10:97099368-97099390 CAGGCTCAACACAGCTGAGTGGG + Intronic
1072850680 10:98888510-98888532 CAAGGTCAAAACAGGTAATTAGG - Intronic
1073542297 10:104324010-104324032 CAGGCTCCCAACATGTAAGTAGG + Intronic
1073910610 10:108338705-108338727 CAGTGACACCACATGTAATTGGG + Intergenic
1077097324 11:804621-804643 CTGGGTCACCACTGGAAAGAGGG + Intronic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1078922580 11:15844298-15844320 CCTGGGCACCAAAGGTAAGTGGG + Intergenic
1081323207 11:41716216-41716238 CAGATTCACCACTGGTAACTTGG - Intergenic
1083018204 11:59478154-59478176 CAGGGTCACCACAGTGATGTGGG - Exonic
1083019502 11:59492376-59492398 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083020719 11:59504300-59504322 CAGGGTCACCACAGTGATGTGGG - Exonic
1083021840 11:59515637-59515659 CAGGGTCACCACGGTGATGTGGG - Exonic
1083023750 11:59532509-59532531 CAGGGTCACCACAGTGATGTGGG - Intergenic
1083309471 11:61777037-61777059 CAGGGTCTCCACAGTAAAGCAGG + Intronic
1083844990 11:65326453-65326475 GAGGGGCCCCACAGGTAAGAAGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085240873 11:75054012-75054034 CAGGGTCATCCCAGGAATGTAGG + Intergenic
1085699048 11:78729913-78729935 CAGGGTCACCACATGAAAACTGG - Intronic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1098221610 12:68275675-68275697 CAAGGTTACCACTGATAAGTTGG - Intronic
1098815939 12:75162414-75162436 CAGGGTCTCCTCAGGTTTGTGGG + Intronic
1102200704 12:111055777-111055799 CAGCCTCCCTACAGGTAAGTAGG + Intronic
1103719324 12:122965103-122965125 CAGGGTCCTCCCAGGGAAGTGGG - Intronic
1109477956 13:62909506-62909528 CAGGTTAACAACAGTTAAGTAGG + Intergenic
1114137487 14:19868398-19868420 AAGGGTCACAACAGTAAAGTGGG + Intergenic
1114140675 14:19906403-19906425 CAGGGTCACCACAGTCACGTGGG - Intergenic
1120279809 14:82424787-82424809 CAGGATGCCCACAGGTAAGAAGG + Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122038509 14:98965290-98965312 CAGGCTCACCACAGGCAGGTGGG + Intergenic
1123003850 14:105312026-105312048 CAGGGCCAGCACTGGTCAGTTGG - Exonic
1124962267 15:34407857-34407879 CAGGCTCAGCACAGCCAAGTGGG - Intronic
1124978890 15:34554078-34554100 CAGGCTCAGCACAGCCAAGTGGG - Intronic
1128376415 15:67079564-67079586 CAGGATCACCCCATGTGAGTGGG - Intronic
1128517431 15:68351423-68351445 CAGGGTCATGAAAGGTAAGTGGG + Intronic
1131153884 15:90063145-90063167 CTGGGTCACCACAGGCCAGCAGG - Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1141108365 16:81252105-81252127 CCTGGTGACCACAGGAAAGTAGG - Intronic
1145991009 17:29079479-29079501 CAGGGTCAGGACTTGTAAGTGGG + Intronic
1148107109 17:45124571-45124593 CAGGGCCAACAGAGGTAAGGAGG + Intronic
1149876218 17:60235797-60235819 CAGGTTCCCCACAGGTAAAATGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1152064352 17:78102258-78102280 CAGAGTCACCACGGGGAAGTGGG + Intronic
1158316857 18:56220832-56220854 GTGGGTCTCTACAGGTAAGTAGG + Intergenic
1159061484 18:63519206-63519228 CAGAGCCACATCAGGTAAGTTGG - Intergenic
1159893200 18:73972333-73972355 CAGGGTCCCCAGAAGTAACTGGG - Intergenic
1160125713 18:76169619-76169641 CTGGGTCACCTCAGATAAGCTGG - Intergenic
1162936469 19:13983996-13984018 CAGGGTCACCCCAGAGAAGGTGG - Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1166852244 19:45766498-45766520 CAGGGTCACCACCTGTGAGGTGG + Exonic
1167521651 19:49959225-49959247 GAGGGTCTACACAGGTAAGAAGG + Intronic
1167523730 19:49971497-49971519 GAGGGTCTACACAGGTAAGAAGG - Intergenic
1167756334 19:51415763-51415785 GAGGGTCTACACAGGTAAGAAGG + Intronic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927678954 2:25127617-25127639 CAGGGTCAGCACAGCTCTGTGGG - Intronic
931888116 2:66640650-66640672 CAGGGTCACCAGTGCTAAATGGG + Intergenic
935639007 2:105272976-105272998 CAGGTACAGCACAGCTAAGTGGG + Exonic
937444939 2:121949825-121949847 CAGGGAGACCACAGGTAACTGGG + Intergenic
938942415 2:136180790-136180812 CAGGAGCAGCACAGGTGAGTGGG + Intergenic
939486766 2:142823433-142823455 CTTGGACACCACAGATAAGTGGG - Intergenic
947262500 2:228239219-228239241 AAGGGAAACCACAGGTAATTGGG + Intergenic
948018507 2:234710246-234710268 CAGCGTCAACACAGGCAAGCTGG - Intergenic
948550929 2:238772681-238772703 CAGGGTCCCCACAGGCACGGAGG + Intergenic
1176088961 20:63310497-63310519 CCTGGTGACCACAGGTAGGTGGG + Exonic
1176222803 20:63978109-63978131 GCGGGTCAGCACAGGTATGTGGG + Intronic
1177867596 21:26531223-26531245 CATGCTCACCACAGGGAAGCTGG + Intronic
1180956726 22:19744560-19744582 CAGGGTCACCACTGGAAACCGGG + Intergenic
1182833269 22:33321026-33321048 CTGGATCATCTCAGGTAAGTGGG + Intronic
949436315 3:4033264-4033286 GAAGGTGGCCACAGGTAAGTGGG + Intronic
949480138 3:4485891-4485913 TAGGGTCAGCCCAGGGAAGTGGG - Intergenic
950735493 3:15004307-15004329 CAAGGTCAACAAAGCTAAGTGGG - Intronic
952266391 3:31790725-31790747 CAGGGTCACCAGGTGTCAGTGGG - Intronic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
959327880 3:104960768-104960790 CAAGGTCATCAGAGGTAAGTCGG + Intergenic
960643151 3:119848217-119848239 CAGGGTTATCCCAGGTAACTGGG - Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961041054 3:123678575-123678597 CAGGCTCACCTCAGGAAAGATGG + Intronic
961971096 3:130969203-130969225 AAGGGTCACCACTTGTAACTAGG - Intronic
970626664 4:17893126-17893148 CAGGGTTGACACTGGTAAGTAGG - Intronic
972337825 4:38123620-38123642 CAGGGTGGCCGCAGGAAAGTGGG - Intronic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
987683014 5:21161860-21161882 CAGGGTCACAACACATTAGTAGG - Intergenic
990642817 5:57806864-57806886 CAGGGCCACCATACGCAAGTGGG + Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
992267808 5:75035173-75035195 CAGGGACACCCCAGCTAGGTAGG + Intergenic
993288499 5:86033976-86033998 CAGGGTTTCCACAGGAAAGCAGG - Intergenic
993467750 5:88269014-88269036 CAGGCGCAGCACAGGTACGTGGG + Intronic
996034223 5:118740014-118740036 CAGGGTCACCACAGCCAGATGGG + Intergenic
998888808 5:146724086-146724108 CAGGGTCTGGACATGTAAGTAGG - Intronic
1001447246 5:171794999-171795021 CAGAGTCCCCACAGGTGAGTGGG + Intergenic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011226884 6:85117698-85117720 CGGGTTCCCCACAGGTAATTTGG + Intergenic
1011677265 6:89746995-89747017 CAGTGTCACCACAGGTAGTCTGG - Intronic
1014218086 6:118772486-118772508 CAGCGTCACCACAGATCCGTAGG + Intergenic
1015296561 6:131600029-131600051 CAGGCCCACTACAGGTAATTTGG - Exonic
1021275272 7:18642360-18642382 CAGGGGAACCACAGAAAAGTAGG - Intronic
1025095428 7:56092251-56092273 CAGGGTCACCACATGGGAGTAGG + Intronic
1030816849 7:114049394-114049416 CAGATTCACCACTGGTAACTTGG + Intronic
1038158230 8:25011322-25011344 CAGGGTCTCCAAAGTTTAGTAGG + Intergenic
1040771495 8:50982927-50982949 CAAGGTAACCACAGGACAGTAGG - Intergenic
1043266100 8:78269196-78269218 AAAGGTCACCCCATGTAAGTGGG + Intergenic
1043294216 8:78644476-78644498 CAGGGTCACCACTTGCAGGTTGG - Intergenic
1044894944 8:96881620-96881642 CAAGGTCCACACAGCTAAGTAGG + Intronic
1047140197 8:122129999-122130021 CAGGGTCACCTGAGGTAACTAGG - Intergenic
1052659343 9:31408063-31408085 CAGGACCACCAAAGGTAAATTGG + Intergenic
1052991735 9:34522768-34522790 CAGGCTCAACTCAGGTAAGAAGG - Exonic
1057794633 9:98146389-98146411 CTGGGTCACAACAGGCAAGAGGG + Intronic
1058811740 9:108646198-108646220 GAGGGTCATCAAAGGCAAGTGGG + Intergenic
1060931308 9:127491282-127491304 CAGAGTCACTCCAGGTATGTAGG + Exonic
1061145200 9:128793607-128793629 CTGGGTCTCCACAGATACGTGGG + Intronic
1062501617 9:136854323-136854345 CGGCCTCACCACAGGTGAGTGGG - Exonic
1062720573 9:138041071-138041093 CAGAGTCCCCACAGGTTAGGGGG - Intronic
1187660389 X:21540119-21540141 CACAGTCACTTCAGGTAAGTTGG + Intronic
1188182465 X:27072932-27072954 GAGGGTGAGCACAGGTGAGTGGG - Intergenic
1197413908 X:126151064-126151086 CAGAGTCACCACAGCTACTTGGG - Intergenic
1199739027 X:150715150-150715172 CAGGGTCACCAAAGGAGAGTGGG - Intronic