ID: 927336890

View in Genome Browser
Species Human (GRCh38)
Location 2:21935507-21935529
Sequence CTTATTCACCAATTCTCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927336890_927336892 7 Left 927336890 2:21935507-21935529 CCTATTGAGAATTGGTGAATAAG No data
Right 927336892 2:21935537-21935559 TGCATCCACAGTTATATTGGTGG No data
927336890_927336895 28 Left 927336890 2:21935507-21935529 CCTATTGAGAATTGGTGAATAAG No data
Right 927336895 2:21935558-21935580 GGAGGCACCCATCACCACCAAGG No data
927336890_927336896 29 Left 927336890 2:21935507-21935529 CCTATTGAGAATTGGTGAATAAG No data
Right 927336896 2:21935559-21935581 GAGGCACCCATCACCACCAAGGG No data
927336890_927336897 30 Left 927336890 2:21935507-21935529 CCTATTGAGAATTGGTGAATAAG No data
Right 927336897 2:21935560-21935582 AGGCACCCATCACCACCAAGGGG No data
927336890_927336891 4 Left 927336890 2:21935507-21935529 CCTATTGAGAATTGGTGAATAAG No data
Right 927336891 2:21935534-21935556 CATTGCATCCACAGTTATATTGG No data
927336890_927336893 10 Left 927336890 2:21935507-21935529 CCTATTGAGAATTGGTGAATAAG No data
Right 927336893 2:21935540-21935562 ATCCACAGTTATATTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927336890 Original CRISPR CTTATTCACCAATTCTCAAT AGG (reversed) Intergenic
No off target data available for this crispr