ID: 927337472

View in Genome Browser
Species Human (GRCh38)
Location 2:21941649-21941671
Sequence ACAGAGAAGCAGAATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927337472_927337479 23 Left 927337472 2:21941649-21941671 CCTCCCCCATTCTGCTTCTCTGT No data
Right 927337479 2:21941695-21941717 CTGTGACTACACAAAGAACAGGG No data
927337472_927337478 22 Left 927337472 2:21941649-21941671 CCTCCCCCATTCTGCTTCTCTGT No data
Right 927337478 2:21941694-21941716 CCTGTGACTACACAAAGAACAGG No data
927337472_927337480 24 Left 927337472 2:21941649-21941671 CCTCCCCCATTCTGCTTCTCTGT No data
Right 927337480 2:21941696-21941718 TGTGACTACACAAAGAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927337472 Original CRISPR ACAGAGAAGCAGAATGGGGG AGG (reversed) Intergenic
No off target data available for this crispr