ID: 927337716

View in Genome Browser
Species Human (GRCh38)
Location 2:21944521-21944543
Sequence GCCCAGTTTTCACGCCCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927337714_927337716 -8 Left 927337714 2:21944506-21944528 CCACAATCACCTTGAGCCCAGTT No data
Right 927337716 2:21944521-21944543 GCCCAGTTTTCACGCCCCTAAGG No data
927337713_927337716 -7 Left 927337713 2:21944505-21944527 CCCACAATCACCTTGAGCCCAGT No data
Right 927337716 2:21944521-21944543 GCCCAGTTTTCACGCCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927337716 Original CRISPR GCCCAGTTTTCACGCCCCTA AGG Intergenic