ID: 927347960

View in Genome Browser
Species Human (GRCh38)
Location 2:22069681-22069703
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927347953_927347960 26 Left 927347953 2:22069632-22069654 CCTCTGCTTGAGGACAGGAAAAG No data
Right 927347960 2:22069681-22069703 GGTACCAACTCAGCCAAAGTGGG No data
927347952_927347960 27 Left 927347952 2:22069631-22069653 CCCTCTGCTTGAGGACAGGAAAA No data
Right 927347960 2:22069681-22069703 GGTACCAACTCAGCCAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr