ID: 927350725

View in Genome Browser
Species Human (GRCh38)
Location 2:22110481-22110503
Sequence AATAATTACCAGAGTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927350723_927350725 -2 Left 927350723 2:22110460-22110482 CCAGACATTAGGTCTGGATTCAA No data
Right 927350725 2:22110481-22110503 AATAATTACCAGAGTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927350725 Original CRISPR AATAATTACCAGAGTAAAGG AGG Intergenic
No off target data available for this crispr