ID: 927356718

View in Genome Browser
Species Human (GRCh38)
Location 2:22181977-22181999
Sequence TAGAGGCATCCCCTTCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927356718_927356725 20 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356725 2:22182020-22182042 GGGGACTCCTCAGAGTCTTGAGG No data
927356718_927356720 -1 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356720 2:22181999-22182021 AGTAAAAGCCTTCTTGCCAGTGG No data
927356718_927356722 1 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356722 2:22182001-22182023 TAAAAGCCTTCTTGCCAGTGGGG No data
927356718_927356721 0 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356721 2:22182000-22182022 GTAAAAGCCTTCTTGCCAGTGGG No data
927356718_927356727 24 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356727 2:22182024-22182046 ACTCCTCAGAGTCTTGAGGTGGG No data
927356718_927356726 23 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927356718 Original CRISPR TAGAGGCATCCCCTTCATGT TGG (reversed) Intergenic
No off target data available for this crispr