ID: 927356719

View in Genome Browser
Species Human (GRCh38)
Location 2:22181994-22182016
Sequence GGCAAGAAGGCTTTTACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927356719_927356726 6 Left 927356719 2:22181994-22182016 CCTCTAGTAAAAGCCTTCTTGCC No data
Right 927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG No data
927356719_927356725 3 Left 927356719 2:22181994-22182016 CCTCTAGTAAAAGCCTTCTTGCC No data
Right 927356725 2:22182020-22182042 GGGGACTCCTCAGAGTCTTGAGG No data
927356719_927356727 7 Left 927356719 2:22181994-22182016 CCTCTAGTAAAAGCCTTCTTGCC No data
Right 927356727 2:22182024-22182046 ACTCCTCAGAGTCTTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927356719 Original CRISPR GGCAAGAAGGCTTTTACTAG AGG (reversed) Intergenic