ID: 927356726

View in Genome Browser
Species Human (GRCh38)
Location 2:22182023-22182045
Sequence GACTCCTCAGAGTCTTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927356719_927356726 6 Left 927356719 2:22181994-22182016 CCTCTAGTAAAAGCCTTCTTGCC No data
Right 927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG No data
927356718_927356726 23 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG No data
927356723_927356726 -7 Left 927356723 2:22182007-22182029 CCTTCTTGCCAGTGGGGACTCCT No data
Right 927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927356726 Original CRISPR GACTCCTCAGAGTCTTGAGG TGG Intergenic
No off target data available for this crispr