ID: 927356727

View in Genome Browser
Species Human (GRCh38)
Location 2:22182024-22182046
Sequence ACTCCTCAGAGTCTTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927356723_927356727 -6 Left 927356723 2:22182007-22182029 CCTTCTTGCCAGTGGGGACTCCT No data
Right 927356727 2:22182024-22182046 ACTCCTCAGAGTCTTGAGGTGGG No data
927356719_927356727 7 Left 927356719 2:22181994-22182016 CCTCTAGTAAAAGCCTTCTTGCC No data
Right 927356727 2:22182024-22182046 ACTCCTCAGAGTCTTGAGGTGGG No data
927356718_927356727 24 Left 927356718 2:22181977-22181999 CCAACATGAAGGGGATGCCTCTA No data
Right 927356727 2:22182024-22182046 ACTCCTCAGAGTCTTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927356727 Original CRISPR ACTCCTCAGAGTCTTGAGGT GGG Intergenic
No off target data available for this crispr