ID: 927360442

View in Genome Browser
Species Human (GRCh38)
Location 2:22225994-22226016
Sequence ATCTTTCACCATTAGCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927360439_927360442 27 Left 927360439 2:22225944-22225966 CCAAATATGGGTGCCATCATCTT No data
Right 927360442 2:22225994-22226016 ATCTTTCACCATTAGCTACAAGG No data
927360440_927360442 14 Left 927360440 2:22225957-22225979 CCATCATCTTATTCTTTATTTCA No data
Right 927360442 2:22225994-22226016 ATCTTTCACCATTAGCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927360442 Original CRISPR ATCTTTCACCATTAGCTACA AGG Intergenic
No off target data available for this crispr