ID: 927360970

View in Genome Browser
Species Human (GRCh38)
Location 2:22232990-22233012
Sequence ATGAAAAAGCAGAAACAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927360968_927360970 -4 Left 927360968 2:22232971-22232993 CCTAGTTAAGAGTTCCAGGATGA No data
Right 927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG No data
927360966_927360970 2 Left 927360966 2:22232965-22232987 CCTAATCCTAGTTAAGAGTTCCA No data
Right 927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927360970 Original CRISPR ATGAAAAAGCAGAAACAGAA AGG Intergenic
No off target data available for this crispr