ID: 927364588

View in Genome Browser
Species Human (GRCh38)
Location 2:22279236-22279258
Sequence TATGTGAGCGGTCCACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927364588_927364591 27 Left 927364588 2:22279236-22279258 CCTTGCAGTGGACCGCTCACATA No data
Right 927364591 2:22279286-22279308 GAATGTTGCCAGAATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927364588 Original CRISPR TATGTGAGCGGTCCACTGCA AGG (reversed) Intergenic
No off target data available for this crispr