ID: 927364803

View in Genome Browser
Species Human (GRCh38)
Location 2:22282022-22282044
Sequence GAAACTACGATGTTTAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927364802_927364803 -10 Left 927364802 2:22282009-22282031 CCAAGTATTTAAGGAAACTACGA No data
Right 927364803 2:22282022-22282044 GAAACTACGATGTTTAGATATGG No data
927364800_927364803 4 Left 927364800 2:22281995-22282017 CCTTCTTTCTAATGCCAAGTATT No data
Right 927364803 2:22282022-22282044 GAAACTACGATGTTTAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927364803 Original CRISPR GAAACTACGATGTTTAGATA TGG Intergenic
No off target data available for this crispr