ID: 927368792

View in Genome Browser
Species Human (GRCh38)
Location 2:22330576-22330598
Sequence AGGGGCTGCCCTTTTTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927368790_927368792 -6 Left 927368790 2:22330559-22330581 CCACCTGGTGCTGTGAGAGGGGC No data
Right 927368792 2:22330576-22330598 AGGGGCTGCCCTTTTTCTTTTGG No data
927368791_927368792 -9 Left 927368791 2:22330562-22330584 CCTGGTGCTGTGAGAGGGGCTGC No data
Right 927368792 2:22330576-22330598 AGGGGCTGCCCTTTTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927368792 Original CRISPR AGGGGCTGCCCTTTTTCTTT TGG Intergenic
No off target data available for this crispr