ID: 927374294

View in Genome Browser
Species Human (GRCh38)
Location 2:22395559-22395581
Sequence CAGGGTGAACAAAAGATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927374290_927374294 1 Left 927374290 2:22395535-22395557 CCAATGGAAACACCACTGCAGAA No data
Right 927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927374294 Original CRISPR CAGGGTGAACAAAAGATAGA AGG Intergenic
No off target data available for this crispr