ID: 927374543

View in Genome Browser
Species Human (GRCh38)
Location 2:22398481-22398503
Sequence AGCATGAGGGTGTGGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927374543_927374551 16 Left 927374543 2:22398481-22398503 CCTTTCTTCCACACCCTCATGCT No data
Right 927374551 2:22398520-22398542 GGTTGCATTCCAGGTTGAGGAGG No data
927374543_927374548 -5 Left 927374543 2:22398481-22398503 CCTTTCTTCCACACCCTCATGCT No data
Right 927374548 2:22398499-22398521 ATGCTGTTATCATTGTCAGGTGG No data
927374543_927374550 13 Left 927374543 2:22398481-22398503 CCTTTCTTCCACACCCTCATGCT No data
Right 927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG No data
927374543_927374549 7 Left 927374543 2:22398481-22398503 CCTTTCTTCCACACCCTCATGCT No data
Right 927374549 2:22398511-22398533 TTGTCAGGTGGTTGCATTCCAGG No data
927374543_927374547 -8 Left 927374543 2:22398481-22398503 CCTTTCTTCCACACCCTCATGCT No data
Right 927374547 2:22398496-22398518 CTCATGCTGTTATCATTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927374543 Original CRISPR AGCATGAGGGTGTGGAAGAA AGG (reversed) Intergenic