ID: 927374544

View in Genome Browser
Species Human (GRCh38)
Location 2:22398489-22398511
Sequence ATGATAACAGCATGAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927374544_927374549 -1 Left 927374544 2:22398489-22398511 CCACACCCTCATGCTGTTATCAT No data
Right 927374549 2:22398511-22398533 TTGTCAGGTGGTTGCATTCCAGG No data
927374544_927374550 5 Left 927374544 2:22398489-22398511 CCACACCCTCATGCTGTTATCAT No data
Right 927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG No data
927374544_927374551 8 Left 927374544 2:22398489-22398511 CCACACCCTCATGCTGTTATCAT No data
Right 927374551 2:22398520-22398542 GGTTGCATTCCAGGTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927374544 Original CRISPR ATGATAACAGCATGAGGGTG TGG (reversed) Intergenic