ID: 927374545

View in Genome Browser
Species Human (GRCh38)
Location 2:22398494-22398516
Sequence TGACAATGATAACAGCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927374545_927374551 3 Left 927374545 2:22398494-22398516 CCCTCATGCTGTTATCATTGTCA No data
Right 927374551 2:22398520-22398542 GGTTGCATTCCAGGTTGAGGAGG No data
927374545_927374549 -6 Left 927374545 2:22398494-22398516 CCCTCATGCTGTTATCATTGTCA No data
Right 927374549 2:22398511-22398533 TTGTCAGGTGGTTGCATTCCAGG No data
927374545_927374550 0 Left 927374545 2:22398494-22398516 CCCTCATGCTGTTATCATTGTCA No data
Right 927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927374545 Original CRISPR TGACAATGATAACAGCATGA GGG (reversed) Intergenic