ID: 927374545 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:22398494-22398516 |
| Sequence | TGACAATGATAACAGCATGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927374545_927374551 | 3 | Left | 927374545 | 2:22398494-22398516 | CCCTCATGCTGTTATCATTGTCA | No data | ||
| Right | 927374551 | 2:22398520-22398542 | GGTTGCATTCCAGGTTGAGGAGG | No data | ||||
| 927374545_927374549 | -6 | Left | 927374545 | 2:22398494-22398516 | CCCTCATGCTGTTATCATTGTCA | No data | ||
| Right | 927374549 | 2:22398511-22398533 | TTGTCAGGTGGTTGCATTCCAGG | No data | ||||
| 927374545_927374550 | 0 | Left | 927374545 | 2:22398494-22398516 | CCCTCATGCTGTTATCATTGTCA | No data | ||
| Right | 927374550 | 2:22398517-22398539 | GGTGGTTGCATTCCAGGTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927374545 | Original CRISPR | TGACAATGATAACAGCATGA GGG (reversed) | Intergenic | ||