ID: 927374550

View in Genome Browser
Species Human (GRCh38)
Location 2:22398517-22398539
Sequence GGTGGTTGCATTCCAGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927374546_927374550 -1 Left 927374546 2:22398495-22398517 CCTCATGCTGTTATCATTGTCAG No data
Right 927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG No data
927374545_927374550 0 Left 927374545 2:22398494-22398516 CCCTCATGCTGTTATCATTGTCA No data
Right 927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG No data
927374543_927374550 13 Left 927374543 2:22398481-22398503 CCTTTCTTCCACACCCTCATGCT No data
Right 927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG No data
927374544_927374550 5 Left 927374544 2:22398489-22398511 CCACACCCTCATGCTGTTATCAT No data
Right 927374550 2:22398517-22398539 GGTGGTTGCATTCCAGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927374550 Original CRISPR GGTGGTTGCATTCCAGGTTG AGG Intergenic