ID: 927374755

View in Genome Browser
Species Human (GRCh38)
Location 2:22400931-22400953
Sequence CAGAGCAGAGAGAAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927374753_927374755 0 Left 927374753 2:22400908-22400930 CCGGGATCTAAAAGGCTTTTGCT No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data
927374745_927374755 22 Left 927374745 2:22400886-22400908 CCCTTTCTACTCCCTTCTACCAC No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data
927374749_927374755 11 Left 927374749 2:22400897-22400919 CCCTTCTACCACCGGGATCTAAA No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data
927374744_927374755 28 Left 927374744 2:22400880-22400902 CCTTTGCCCTTTCTACTCCCTTC No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data
927374752_927374755 3 Left 927374752 2:22400905-22400927 CCACCGGGATCTAAAAGGCTTTT No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data
927374743_927374755 29 Left 927374743 2:22400879-22400901 CCCTTTGCCCTTTCTACTCCCTT No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data
927374746_927374755 21 Left 927374746 2:22400887-22400909 CCTTTCTACTCCCTTCTACCACC No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data
927374750_927374755 10 Left 927374750 2:22400898-22400920 CCTTCTACCACCGGGATCTAAAA No data
Right 927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927374755 Original CRISPR CAGAGCAGAGAGAAGTAGGC AGG Intergenic
No off target data available for this crispr