ID: 927376168

View in Genome Browser
Species Human (GRCh38)
Location 2:22417259-22417281
Sequence GTCTCACAGTTCCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927376164_927376168 16 Left 927376164 2:22417220-22417242 CCGAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 927376168 2:22417259-22417281 GTCTCACAGTTCCACGTGGCTGG No data
927376163_927376168 17 Left 927376163 2:22417219-22417241 CCCGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 927376168 2:22417259-22417281 GTCTCACAGTTCCACGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927376168 Original CRISPR GTCTCACAGTTCCACGTGGC TGG Intergenic
No off target data available for this crispr