ID: 927383248

View in Genome Browser
Species Human (GRCh38)
Location 2:22503081-22503103
Sequence GTTAGTTTTCTATCAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927383248_927383252 15 Left 927383248 2:22503081-22503103 CCAGGAGTTGATAGAAAACTAAC No data
Right 927383252 2:22503119-22503141 CCAATTAATTTTGTCTTTTTGGG No data
927383248_927383250 14 Left 927383248 2:22503081-22503103 CCAGGAGTTGATAGAAAACTAAC No data
Right 927383250 2:22503118-22503140 ACCAATTAATTTTGTCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927383248 Original CRISPR GTTAGTTTTCTATCAACTCC TGG (reversed) Intergenic
No off target data available for this crispr