ID: 927384611

View in Genome Browser
Species Human (GRCh38)
Location 2:22518568-22518590
Sequence TTAAGTCCAAACTAAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927384610_927384611 23 Left 927384610 2:22518522-22518544 CCTTTTTAATCAAAGGACAGGGA No data
Right 927384611 2:22518568-22518590 TTAAGTCCAAACTAAAAGCCTGG No data
927384608_927384611 24 Left 927384608 2:22518521-22518543 CCCTTTTTAATCAAAGGACAGGG No data
Right 927384611 2:22518568-22518590 TTAAGTCCAAACTAAAAGCCTGG No data
927384606_927384611 25 Left 927384606 2:22518520-22518542 CCCCTTTTTAATCAAAGGACAGG No data
Right 927384611 2:22518568-22518590 TTAAGTCCAAACTAAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927384611 Original CRISPR TTAAGTCCAAACTAAAAGCC TGG Intergenic
No off target data available for this crispr