ID: 927387075

View in Genome Browser
Species Human (GRCh38)
Location 2:22547223-22547245
Sequence TTTCTATTCTAGGGGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927387071_927387075 1 Left 927387071 2:22547199-22547221 CCATTTTGGCTTCTGGAAGTATT No data
Right 927387075 2:22547223-22547245 TTTCTATTCTAGGGGCTCAAAGG No data
927387070_927387075 2 Left 927387070 2:22547198-22547220 CCCATTTTGGCTTCTGGAAGTAT No data
Right 927387075 2:22547223-22547245 TTTCTATTCTAGGGGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927387075 Original CRISPR TTTCTATTCTAGGGGCTCAA AGG Intergenic
No off target data available for this crispr