ID: 927395955

View in Genome Browser
Species Human (GRCh38)
Location 2:22651519-22651541
Sequence GACTTGGACATAAAATATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927395955_927395959 -3 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395959 2:22651539-22651561 GTCCAAAGGGTCCAGATTGATGG No data
927395955_927395961 6 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395961 2:22651548-22651570 GTCCAGATTGATGGTGAGCCAGG No data
927395955_927395964 21 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395964 2:22651563-22651585 GAGCCAGGCTGAAGAAAGGCTGG No data
927395955_927395963 17 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395963 2:22651559-22651581 TGGTGAGCCAGGCTGAAGAAAGG No data
927395955_927395965 22 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395965 2:22651564-22651586 AGCCAGGCTGAAGAAAGGCTGGG No data
927395955_927395966 23 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395966 2:22651565-22651587 GCCAGGCTGAAGAAAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927395955 Original CRISPR GACTTGGACATAAAATATTT TGG (reversed) Intergenic
No off target data available for this crispr